nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (NFKBIA) - 329 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6109
gtgcgccgcttgcctggcccgggttctctctgaccctgggacgtagctgatgtagcagag  c.336+60

         .         .         .         .         .         .  g.6169
tcaccccagatcctttctgaattcagggccactgagcactatttaccctcaccttttact  c.336+120

         .         .         .         .       g.6214
tcacatcagcccacatcctagagagtgaaggaaattccactgatt  c.336+165

--------------------- middle of intron ---------------------
     g.6215         .         .         .         .           g.6258
     c.337-164  tggtgaggtctttatgacccacctggagcctctgctatttgcca  c.337-121

.         .         .         .         .         .           g.6318
gccctccccacccccctgtctaggaggagcagcacccaaccaggagacacgggttgaggg  c.337-61

.         .         .         .         .         .           g.6378
gaactcggggtgtgggtttggtccatggcttactttctctggtctctcttgcattcgtag  c.337-1


Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center