NHP2 ribonucleoprotein (NHP2) - coding DNA reference sequence

(used for variant description)

(last modified October 26, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_017838.3 in the NHP2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011765.1, covering NHP2 transcript NM_017838.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5023
                                      attgggctgagtcggagacttcc       c.-121

 .         .         .         .         .         .                g.5083
 tttcctgattggccgtgttgtacggcggcttctcgcgcagctgatgacctggaagtgatg       c.-61

 .         .         .         .         .         .                g.5143
 cctaaagctgtggaccgcgtgggctcgcctccctgggactaggtttcagcggccgctgcg       c.-1

          .         .         .         .         .         .       g.5203
 ATGACCAAAATAAAGGCAGATCCCGACGGGCCCGAGGCTCAGGCGGAGGCGTGTTCCGGG       c.60
 M  T  K  I  K  A  D  P  D  G  P  E  A  Q  A  E  A  C  S  G         p.20

          .         .         .         .         .         .       g.5263
 GAGCGCACCTACCAGGAGCTGCTGGTCAACCAGAACCCCATCGCGCAGCCCCTGGCTTCT       c.120
 E  R  T  Y  Q  E  L  L  V  N  Q  N  P  I  A  Q  P  L  A  S         p.40

          .         .         .         . | 02       .         .    g.5420
 CGCCGCCTCACGCGGAAGCTCTACAAATGCATCAAGAAAG | CGGTGAAGCAGAAGCAGATT    c.180
 R  R  L  T  R  K  L  Y  K  C  I  K  K  A |   V  K  Q  K  Q  I      p.60

          .         .         .         .         . | 03       .    g.7977
 CGGCGCGGGGTGAAAGAGGTTCAGAAATTTGTCAACAAAGGAGAAAAAGG | GATCATGGTT    c.240
 R  R  G  V  K  E  V  Q  K  F  V  N  K  G  E  K  G  |  I  M  V      p.80

          .         .         .         .         .         .       g.8037
 TTGGCAGGAGACACACTGCCCATTGAGGTATACTGCCATCTCCCAGTCATGTGTGAGGAC       c.300
 L  A  G  D  T  L  P  I  E  V  Y  C  H  L  P  V  M  C  E  D         p.100

          .         .         .       | 04 .         .         .    g.9146
 CGAAATTTGCCCTATGTCTATATCCCCTCTAAGACG | GACCTGGGTGCAGCCGCAGGCTCC    c.360
 R  N  L  P  Y  V  Y  I  P  S  K  T   | D  L  G  A  A  A  G  S      p.120

          .         .         .         .         .         .       g.9206
 AAGCGCCCCACCTGTGTGATAATGGTCAAGCCCCATGAGGAGTACCAGGAGGCTTACGAT       c.420
 K  R  P  T  C  V  I  M  V  K  P  H  E  E  Y  Q  E  A  Y  D         p.140

          .         .         .         .                           g.9248
 GAGTGCCTGGAGGAGGTGCAGTCCCTGCCCCTACCCCTATGA                         c.462
 E  C  L  E  E  V  Q  S  L  P  L  P  L  X                           p.153

          .         .         .         .         .         .       g.9308
 ggggctccggtagcacctgggcacctgccgctggaagctattgggctggcagcaggacga       c.*60

          .         .         .         .         .         .       g.9368
 ctggctgtcctcctgcccacccacactgacggcatcttcccagttccccaaggcacgcct       c.*120

          .         .         .         .         .         .       g.9428
 tcttcccaggcagctctaacagccctttcatgaaggtaatgctagtcttctgtccatcag       c.*180

          .         .         .         .         .         .       g.9488
 tgccatttcctgtagaactaaaggctgttccaagaatgtggggtggggaaagtaaatgct       c.*240

          .                                                         g.9498
 aagactaaaa                                                         c.*250

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The NHP2 ribonucleoprotein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.