Nipped-B homolog (Drosophila) (NIPBL) - coding DNA reference sequence

(used for variant description)

(last modified June 26, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_133433.3 in the NIPBL gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_006987.1, covering NIPBL transcript NM_133433.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.4895
                                          tccggtcggcattttgttc       c.-481

 .         .         .         .         .         .                g.4955
 tgagagggagagacggaacgagagagagacacacacagggctccttccccccgccctccc       c.-421

 .         .         .         .         .         .                g.5015
 ccccctccctccgtcggtaccgactcacccgacaccaccaagccgcagggagggacgccc       c.-361

 .         .         .         .         .         .                g.5075
 ccgccgacaggagaattggttcccgggcccgcggcgatgcccccccggtagctcgggccc       c.-301

 .         .         .         .         .         .                g.5135
 gtggtcgggtgtttgtgagtgtttctatgtgggagaaggaggaggaggaggaagaagaag       c.-241

 .         .         .         .         .         .                g.5195
 caacgatttgtcttctcggctggtctccccccggctctacatgttccccgcactgaggag       c.-181

 .         .         .         .         .         .                g.5255
 acggaagaggagccgtagccaccccccctcccggcccggattatagtctctcgccacagc       c.-121

 .         .         .         .         . | 02       .             g.81754
 ggcctcggcctccccttggattcagacgccgattcgcccag | tgtttgggaaatgggaagt    c.-61

 .         .         .         .         .         .                g.81814
 aatgacagctggcacctgaactaagtacttttataggcaacaccattccagaaattcagg       c.-1

          .         .         .         .         .         .       g.81874
 ATGAATGGGGATATGCCCCATGTCCCCATTACTACTCTTGCGGGGATTGCTAGTCTCACA       c.60
 M  N  G  D  M  P  H  V  P  I  T  T  L  A  G  I  A  S  L  T         p.20

      | 03   .         .         .         .         .         .    g.83645
 GACC | TCCTGAACCAGCTGCCTCTTCCATCTCCTTTACCTGCTACAACTACAAAGAGCCTT    c.120
 D  L |   L  N  Q  L  P  L  P  S  P  L  P  A  T  T  T  K  S  L      p.40

          .         .         .         .         .         .       g.83705
 CTCTTTAATGCACGAATAGCAGAAGAGGTGAACTGCCTTTTGGCTTGTAGGGATGACAAT       c.180
 L  F  N  A  R  I  A  E  E  V  N  C  L  L  A  C  R  D  D  N         p.60

          .         .         .         .         . | 04       .    g.86231
 TTGGTTTCACAGCTTGTCCATAGCCTCAACCAGGTATCAACAGATCACAT | AGAGTTGAAA    c.240
 L  V  S  Q  L  V  H  S  L  N  Q  V  S  T  D  H  I  |  E  L  K      p.80

          .         .         .         .         .         .       g.86291
 GATAACCTTGGCAGTGATGACCCAGAAGGTGACATACCAGTCTTGTTGCAGGCCGTCCTG       c.300
 D  N  L  G  S  D  D  P  E  G  D  I  P  V  L  L  Q  A  V  L         p.100

          .         .         .         .         .         | 05    g.89603
 GCAAGGAGTCCTAATGTTTTCAGGGAGAAAAGCATGCAGAACAGATATGTACAAAGTG | GA    c.360
 A  R  S  P  N  V  F  R  E  K  S  M  Q  N  R  Y  V  Q  S  G |       p.120

          .         .         .         .         .         .       g.89663
 ATGATGATGTCTCAGTATAAACTTTCTCAGAATTCCATGCACAGTAGTCCTGCATCTTCC       c.420
 M  M  M  S  Q  Y  K  L  S  Q  N  S  M  H  S  S  P  A  S  S         p.140

          .         .         .         | 06         .         .    g.90262
 AATTATCAACAAACCACTATCTCACATAGCCCCTCCAG | CCGGTTTGTGCCACCACAGACA    c.480
 N  Y  Q  Q  T  T  I  S  H  S  P  S  S  |  R  F  V  P  P  Q  T      p.160

          .         .         .         .         .         .       g.90322
 AGCTCTGGGAACAGATTTATGCCACAGCAAAATAGCCCAGTGCCTAGTCCATACGCCCCA       c.540
 S  S  G  N  R  F  M  P  Q  Q  N  S  P  V  P  S  P  Y  A  P         p.180

          .         .         .         .         .         .       g.90382
 CAAAGCCCTGCAGGATACATGCCATATTCCCATCCTTCAAGTTACACAACACATCCACAG       c.600
 Q  S  P  A  G  Y  M  P  Y  S  H  P  S  S  Y  T  T  H  P  Q         p.200

          . | 07       .         .         .         .         .    g.99043
 ATGCAACAAG | CATCGGTATCAAGTCCCATTGTTGCAGGTGGTTTGAGAAACATACATGAT    c.660
 M  Q  Q  A |   S  V  S  S  P  I  V  A  G  G  L  R  N  I  H  D      p.220

          .         .         .         .         .         .       g.99103
 AATAAAGTTTCTGGTCCGTTGTCTGGCAATTCAGCTAATCATCATGCTGATAATCCTAGA       c.720
 N  K  V  S  G  P  L  S  G  N  S  A  N  H  H  A  D  N  P  R         p.240

          .         .         .         .         .  | 08      .    g.100071
 CATGGTTCAAGTGAGGACTACCTACACATGGTGCACAGGCTAAGTAGTGAC | GATGGAGAT    c.780
 H  G  S  S  E  D  Y  L  H  M  V  H  R  L  S  S  D   | D  G  D      p.260

          .         .         .         .         .         .       g.100131
 TCTTCAACAATGAGGAATGCTGCATCTTTTCCCTTGAGATCTCCACAGCCAGTATGCTCC       c.840
 S  S  T  M  R  N  A  A  S  F  P  L  R  S  P  Q  P  V  C  S         p.280

          .         .         | 09         .         .         .    g.103925
 CCTGCTGGAAGTGAAGGAACTCCTAAAG | GCTCAAGACCACCTTTAATCCTACAATCTCAG    c.900
 P  A  G  S  E  G  T  P  K  G |   S  R  P  P  L  I  L  Q  S  Q      p.300

          .         .         .         .         .         .       g.103985
 TCTCTACCTTGTTCATCACCTCGAGATGTTCCACCAGATATCTTGCTAGATTCTCCAGAA       c.960
 S  L  P  C  S  S  P  R  D  V  P  P  D  I  L  L  D  S  P  E         p.320

          .         .         .         .         .         .       g.104045
 AGAAAACAAAAGAAGCAGAAGAAAATGAAATTAGGCAAGGATGAAAAAGAGCAGAGTGAG       c.1020
 R  K  Q  K  K  Q  K  K  M  K  L  G  K  D  E  K  E  Q  S  E         p.340

          .         .         .         .         .         .       g.104105
 AAAGCGGCAATGTATGATATAATTAGTTCTCCATCCAAGGACTCTACTAAACTTACATTA       c.1080
 K  A  A  M  Y  D  I  I  S  S  P  S  K  D  S  T  K  L  T  L         p.360

          .         .         .         .         .         .       g.104165
 AGACTTTCTCGTGTAAGGTCTTCAGACATGGACCAGCAAGAGGATATGATTTCTGGTGTG       c.1140
 R  L  S  R  V  R  S  S  D  M  D  Q  Q  E  D  M  I  S  G  V         p.380

          .         .         .         .         .         .       g.104225
 GAAAATAGCAATGTTTCAGAAAATGATATTCCTTTTAATGTGCAGTACCCAGGACAGACT       c.1200
 E  N  S  N  V  S  E  N  D  I  P  F  N  V  Q  Y  P  G  Q  T         p.400

          .         .         .         .         .         .       g.104285
 TCAAAAACACCCATTACTCCACAAGATATAAACCGCCCACTAAATGCTGCTCAATGTTTG       c.1260
 S  K  T  P  I  T  P  Q  D  I  N  R  P  L  N  A  A  Q  C  L         p.420

          .         .         .         .         .         .       g.104345
 TCGCAGCAAGAACAAACAGCATTCCTTCCAGCAAATCAAGTGCCTGTTTTACAACAGAAC       c.1320
 S  Q  Q  E  Q  T  A  F  L  P  A  N  Q  V  P  V  L  Q  Q  N         p.440

          .         .         .         .         .         .       g.104405
 ACTTCAGTTGCTGCAAAACAACCCCAGACTTCTGTGGTACAGAATCAACAACAGATATCA       c.1380
 T  S  V  A  A  K  Q  P  Q  T  S  V  V  Q  N  Q  Q  Q  I  S         p.460

          .         .         .         .         .         .       g.104465
 CAACAGGGACCTATATATGATGAAGTGGAATTGGATGCATTGGCTGAAATTGAGCGAATA       c.1440
 Q  Q  G  P  I  Y  D  E  V  E  L  D  A  L  A  E  I  E  R  I         p.480

          .         .         .         .         .      | 10  .    g.112798
 GAGAGAGAATCAGCTATTGAAAGGGAGCGCTTCTCAAAAGAAGTTCAAGATAAAG | ATAAG    c.1500
 E  R  E  S  A  I  E  R  E  R  F  S  K  E  V  Q  D  K  D |   K      p.500

          .         .         .         .         .         .       g.112858
 CCTTTGAAAAAAAGAAAACAAGATTCTTACCCACAGGAGGCTGGGGGTGCTACAGGAGGT       c.1560
 P  L  K  K  R  K  Q  D  S  Y  P  Q  E  A  G  G  A  T  G  G         p.520

          .         .         .         .         .         .       g.112918
 AATAGACCAGCTTCTCAGGAGACGGGTTCTACGGGAAATGGGTCAAGGCCAGCATTAATG       c.1620
 N  R  P  A  S  Q  E  T  G  S  T  G  N  G  S  R  P  A  L  M         p.540

          .         .         .         .         .         .       g.112978
 GTTAGCATTGATCTTCATCAGGCAGGAAGAGTGGACTCTCAGGCTTCTATAACTCAGGAT       c.1680
 V  S  I  D  L  H  Q  A  G  R  V  D  S  Q  A  S  I  T  Q  D         p.560

          .         .         .         .         .         .       g.113038
 TCAGACTCCATAAAAAAGCCTGAAGAAATCAAACAATGTAATGATGCACCTGTTTCTGTT       c.1740
 S  D  S  I  K  K  P  E  E  I  K  Q  C  N  D  A  P  V  S  V         p.580

          .         .         .         .         .         .       g.113098
 CTTCAGGAAGATATTGTTGGAAGTCTTAAATCTACACCAGAAAACCATCCTGAGACACCT       c.1800
 L  Q  E  D  I  V  G  S  L  K  S  T  P  E  N  H  P  E  T  P         p.600

          .         .         .         .         .         .       g.113158
 AAAAAAAAGTCTGATCCTGAGCTTTCAAAGAGTGAAATGAAACAAAGTGAAAGTAGATTA       c.1860
 K  K  K  S  D  P  E  L  S  K  S  E  M  K  Q  S  E  S  R  L         p.620

          .         .         .         .         .         .       g.113218
 GCAGAATCTAAACCAAATGAAAACCGATTGGTGGAGACAAAATCAAGTGAAAATAAGTTA       c.1920
 A  E  S  K  P  N  E  N  R  L  V  E  T  K  S  S  E  N  K  L         p.640

          .         .         .         .         .         .       g.113278
 GAAACTAAAGTTGAGACCCAAACAGAAGAACTTAAACAGAATGAGAGCAGAACAACTGAA       c.1980
 E  T  K  V  E  T  Q  T  E  E  L  K  Q  N  E  S  R  T  T  E         p.660

          .         .         .         .         .         .       g.113338
 TGCAAACAAAACGAGAGCACCATAGTTGAGCCTAAACAAAATGAAAATAGACTGTCTGAC       c.2040
 C  K  Q  N  E  S  T  I  V  E  P  K  Q  N  E  N  R  L  S  D         p.680

          .         .         .         .         .         .       g.113398
 ACAAAACCAAATGACAACAAACAAAATAATGGCAGATCAGAAACAACAAAATCAAGGCCT       c.2100
 T  K  P  N  D  N  K  Q  N  N  G  R  S  E  T  T  K  S  R  P         p.700

          .         .         .         .         .         .       g.113458
 GAAACCCCAAAGCAAAAGGGTGAAAGCCGGCCTGAGACTCCAAAACAAAAGAGTGATGGG       c.2160
 E  T  P  K  Q  K  G  E  S  R  P  E  T  P  K  Q  K  S  D  G         p.720

          .         .         .         .         .         .       g.113518
 CATCCTGAAACCCCAAAACAGAAGGGTGATGGAAGGCCTGAAACTCCAAAGCAAAAAGGT       c.2220
 H  P  E  T  P  K  Q  K  G  D  G  R  P  E  T  P  K  Q  K  G         p.740

          .         .         .         .         .         .       g.113578
 GAGAGCCGCCCTGAAACTCCAAAGCAAAAAAATGAAGGGCGACCTGAAACACCAAAACAC       c.2280
 E  S  R  P  E  T  P  K  Q  K  N  E  G  R  P  E  T  P  K  H         p.760

          .         .         .         .         .         .       g.113638
 AGGCATGACAATAGGAGGGATTCTGGAAAGCCATCTACAGAGAAAAAACCTGAAGTGTCT       c.2340
 R  H  D  N  R  R  D  S  G  K  P  S  T  E  K  K  P  E  V  S         p.780

          .         .         .         .         .         .       g.113698
 AAACATAAACAAGATACTAAATCTGACTCACCTCGGTTAAAATCAGAACGAGCTGAAGCC       c.2400
 K  H  K  Q  D  T  K  S  D  S  P  R  L  K  S  E  R  A  E  A         p.800

          .         .         .         .         .         .       g.113758
 TTAAAGCAGAGACCTGATGGGCGATCTGTTTCTGAGTCACTAAGACGTGACCATGATAAT       c.2460
 L  K  Q  R  P  D  G  R  S  V  S  E  S  L  R  R  D  H  D  N         p.820

          .         .         .         .         .         .       g.113818
 AAACAAAAATCAGATGACAGGGGTGAATCAGAGCGACATCGAGGGGATCAGTCTAGGGTT       c.2520
 K  Q  K  S  D  D  R  G  E  S  E  R  H  R  G  D  Q  S  R  V         p.840

          .         .         .         .         .         .       g.113878
 CGAAGACCAGAAACATTGAGATCCTCTAGTAGAAATGAACATGGCATTAAATCTGATAGT       c.2580
 R  R  P  E  T  L  R  S  S  S  R  N  E  H  G  I  K  S  D  S         p.860

          .         .         .         .         .         .       g.113938
 TCAAAAACTGATAAACTAGAACGAAAACACAGGCATGAATCAGGGGACTCAAGGGAAAGA       c.2640
 S  K  T  D  K  L  E  R  K  H  R  H  E  S  G  D  S  R  E  R         p.880

          .         .         .         .         .         .       g.113998
 CCATCTTCTGGGGAACAAAAATCAAGACCTGACAGTCCTCGTGTTAAACAAGGAGATTCT       c.2700
 P  S  S  G  E  Q  K  S  R  P  D  S  P  R  V  K  Q  G  D  S         p.900

          .         .         .         .         .         .       g.114058
 AATAAATCAAGATCTGATAAACTTGGTTTTAAATCACCAACTAGTAAAGATGACAAAAGG       c.2760
 N  K  S  R  S  D  K  L  G  F  K  S  P  T  S  K  D  D  K  R         p.920

          .         .         .         .         .         .       g.114118
 ACAGAGGGTAACAAGAGTAAAGTAGACACTAATAAAGCACACCCTGACAATAAGGCAGAA       c.2820
 T  E  G  N  K  S  K  V  D  T  N  K  A  H  P  D  N  K  A  E         p.940

          .         .         .         .         .         .       g.114178
 TTTCCAAGTTATTTGTTGGGGGGCAGGTCTGGTGCGTTGAAAAATTTTGTCATTCCGAAA       c.2880
 F  P  S  Y  L  L  G  G  R  S  G  A  L  K  N  F  V  I  P  K         p.960

          .         .         .         .         .         .       g.114238
 ATCAAGAGGGATAAAGATGGCAATGTTACTCAGGAGACAAAGAAAATGGAAATGAAAGGA       c.2940
 I  K  R  D  K  D  G  N  V  T  Q  E  T  K  K  M  E  M  K  G         p.980

          .         .         .         .         .         .       g.114298
 GAGCCGAAAGACAAAGTAGAAAAAATAGGATTAGTTGAAGATCTAAATAAAGGAGCTAAG       c.3000
 E  P  K  D  K  V  E  K  I  G  L  V  E  D  L  N  K  G  A  K         p.1000

          .         .         .         .         .         .       g.114358
 CCTGTAGTTGTGCTACAAAAACTGTCTTTGGATGATGTTCAGAAACTTATTAAAGATAGA       c.3060
 P  V  V  V  L  Q  K  L  S  L  D  D  V  Q  K  L  I  K  D  R         p.1020

          .         .         .         .         .         .       g.114418
 GAGGACAAATCAAGAAGTTCCCTTAAACCTATCAAGAATAAACCATCAAAGTCAAATAAA       c.3120
 E  D  K  S  R  S  S  L  K  P  I  K  N  K  P  S  K  S  N  K         p.1040

   | 11      .         .         .         .         .         .    g.123798
 G | GTAGTATAGATCAATCAGTGTTAAAAGAATTACCCCCTGAACTCCTGGCAGAAATTGAG    c.3180
 G |   S  I  D  Q  S  V  L  K  E  L  P  P  E  L  L  A  E  I  E      p.1060

          .         .         .         .         .         .       g.123858
 TCCACCATGCCACTTTGTGAACGTGTGAAAATGAACAAACGCAAGCGTAGCACAGTTAAT       c.3240
 S  T  M  P  L  C  E  R  V  K  M  N  K  R  K  R  S  T  V  N         p.1080

          .         .         .         .         .         .       g.123918
 GAAAAGCCAAAATATGCTGAAATCAGTTCAGATGAAGATAATGATAGTGATGAAGCTTTT       c.3300
 E  K  P  K  Y  A  E  I  S  S  D  E  D  N  D  S  D  E  A  F         p.1100

      | 12   .         .         .         .         .         .    g.128546
 GAAT | CCTCTAGGAAACGACATAAAAAAGATGATGATAAAGCTTGGGAATATGAAGAGCGT    c.3360
 E  S |   S  R  K  R  H  K  K  D  D  D  K  A  W  E  Y  E  E  R      p.1120

          .         .         .         .         .         .       g.128606
 GACAGAAGAAGCTCTGGGGATCATAGGAGAAGTGGCCACTCTCATGAAGGAAGAAGGAGT       c.3420
 D  R  R  S  S  G  D  H  R  R  S  G  H  S  H  E  G  R  R  S         p.1140

          .         .         .         .         .         .       g.128666
 TCAGGTGGTGGTCGTTATCGAAACCGAAGTCCGTCAGATTCTGACATGGAAGATTATTCT       c.3480
 S  G  G  G  R  Y  R  N  R  S  P  S  D  S  D  M  E  D  Y  S         p.1160

          .         .   | 13     .         .         .         .    g.128972
 CCTCCTCCCAGCCTTAGTGAGG | TTGCTAGGAAAATGAAGAAAAAAGAAAAACAGAAGAAA    c.3540
 P  P  P  S  L  S  E  V |   A  R  K  M  K  K  K  E  K  Q  K  K      p.1180

          .         .         .     | 14   .         .         .    g.129132
 AGGAAAGCATATGAACCAAAACTAACACCTGAAG | AAATGATGGACTCTTCAACTTTTAAG    c.3600
 R  K  A  Y  E  P  K  L  T  P  E  E |   M  M  D  S  S  T  F  K      p.1200

          .         .         .         .         .         .       g.129192
 AGATTCACAGCCTCAATAGAGAATATTTTGGATAATTTGGAAGATATGGATTTTACTGCG       c.3660
 R  F  T  A  S  I  E  N  I  L  D  N  L  E  D  M  D  F  T  A         p.1220

      | 15   .         .         .         .         .         .    g.130835
 TTTG | GTGATGATGATGAAATTCCTCAGGAACTGCTCTTAGGAAAACATCAGCTTAATGAA    c.3720
 F  G |   D  D  D  E  I  P  Q  E  L  L  L  G  K  H  Q  L  N  E      p.1240

          .         .         .         .         | 16         .    g.131390
 CTTGGCAGTGAATCTGCTAAAATAAAAGCAATGGGTATAATGGATAAG | CTTTCAACTGAC    c.3780
 L  G  S  E  S  A  K  I  K  A  M  G  I  M  D  K   | L  S  T  D      p.1260

          .         .         .         .         .         .       g.131450
 AAAACTGTGAAAGTCTTAAATATCTTGGAGAAGAATATTCAGGATGGGTCAAAGCTTTCC       c.3840
 K  T  V  K  V  L  N  I  L  E  K  N  I  Q  D  G  S  K  L  S         p.1280

          .      | 17  .         .         .         .         .    g.134519
 ACTTTGTTAAATCAT | AATAACGATACTGAAGAAGAAGAAAGGTTATGGAGAGACCTTATT    c.3900
 T  L  L  N  H   | N  N  D  T  E  E  E  E  R  L  W  R  D  L  I      p.1300

          .         .         .         .         .         .       g.134579
 ATGGAGAGAGTTACAAAATCAGCGGATGCTTGTCTTACAACTATCAACATTATGACATCC       c.3960
 M  E  R  V  T  K  S  A  D  A  C  L  T  T  I  N  I  M  T  S         p.1320

          .         .         .         .         .         .       g.134639
 CCTAACATGCCAAAAGCTGTGTACATTGAGGATGTAATTGAAAGAGTTATACAGTACACT       c.4020
 P  N  M  P  K  A  V  Y  I  E  D  V  I  E  R  V  I  Q  Y  T         p.1340

          .         .         .         .         .         .       g.134699
 AAATTTCATTTGCAGAATACACTTTATCCTCAGTATGATCCTGTTTACAGATTAGATCCT       c.4080
 K  F  H  L  Q  N  T  L  Y  P  Q  Y  D  P  V  Y  R  L  D  P         p.1360

         | 18.         .         .         .         .         .    g.135493
 CATGGAG | GAGGCTTATTAAGTTCAAAAGCAAAACGGGCTAAATGTTCTACCCATAAGCAG    c.4140
 H  G  G |   G  L  L  S  S  K  A  K  R  A  K  C  S  T  H  K  Q      p.1380

          .         .         .         .         .         .       g.135553
 AGAGTAATAGTAATGCTTTATAACAAAGTTTGTGACATTGTTAGCAGCTTATCAGAATTG       c.4200
 R  V  I  V  M  L  Y  N  K  V  C  D  I  V  S  S  L  S  E  L         p.1400

          .         .         .          | 19        .         .    g.136146
 CTAGAGATACAACTTCTTACAGACACAACAATTCTTCAG | GTTTCATCTATGGGAATAACA    c.4260
 L  E  I  Q  L  L  T  D  T  T  I  L  Q   | V  S  S  M  G  I  T      p.1420

          .         .         .         .         .         .       g.136206
 CCATTTTTTGTGGAAAATGTCAGTGAACTACAGTTGTGTGCCATTAAGTTAGTCACTGCA       c.4320
 P  F  F  V  E  N  V  S  E  L  Q  L  C  A  I  K  L  V  T  A         p.1440

  | 20       .         .         .         .         .         .    g.136800
  | GTATTCTCAAGATATGAAAAACATAGGCAGTTAATTTTGGAAGAAATTTTTACTTCACTT    c.4380
  | V  F  S  R  Y  E  K  H  R  Q  L  I  L  E  E  I  F  T  S  L      p.1460

          .         .         .         .  | 21      .         .    g.138223
 GCAAGATTACCAACCAGCAAGAGGAGTTTAAGGAACTTCAG | GTTAAACAGTAGTGATATG    c.4440
 A  R  L  P  T  S  K  R  S  L  R  N  F  R  |  L  N  S  S  D  M      p.1480

          .         .         .         .         .         .       g.138283
 GATGGAGAACCTATGTATATTCAGATGGTTACAGCACTGGTTTTACAACTTATTCAGTGT       c.4500
 D  G  E  P  M  Y  I  Q  M  V  T  A  L  V  L  Q  L  I  Q  C         p.1500

          .         .         .         .         .         .       g.138343
 GTGGTACACTTACCATCATCAGAGAAGGACTCTAATGCAGAAGAAGATTCAAATAAAAAA       c.4560
 V  V  H  L  P  S  S  E  K  D  S  N  A  E  E  D  S  N  K  K         p.1520

  | 22       .         .         .         .         .         .    g.142860
  | ATTGACCAGGATGTTGTCATTACTAACTCTTATGAAACAGCTATGCGAACAGCCCAAAAC    c.4620
  | I  D  Q  D  V  V  I  T  N  S  Y  E  T  A  M  R  T  A  Q  N      p.1540

          .         .    | 23    .         .         .         .    g.144192
 TTCCTCTCCATCTTCCTTAAAAA | ATGTGGTAGTAAGCAAGGTGAAGAAGATTACAGACCA    c.4680
 F  L  S  I  F  L  K  K  |  C  G  S  K  Q  G  E  E  D  Y  R  P      p.1560

          .         .         .         .         .         .       g.144252
 CTGTTTGAAAATTTTGTTCAAGACCTTCTTTCAACAGTCAATAAGCCTGAATGGCCAGCT       c.4740
 L  F  E  N  F  V  Q  D  L  L  S  T  V  N  K  P  E  W  P  A         p.1580

          .         .         .       | 24 .         .         .    g.145160
 GCTGAACTACTCCTTAGTTTGTTAGGGAGACTGTTG | GTTCATCAGTTCAGTAACAAGTCA    c.4800
 A  E  L  L  L  S  L  L  G  R  L  L   | V  H  Q  F  S  N  K  S      p.1600

          .         .         .         .         .         .       g.145220
 ACAGAGATGGCTTTAAGAGTGGCATCTCTTGATTACCTTGGAACTGTTGCTGCACGGCTA       c.4860
 T  E  M  A  L  R  V  A  S  L  D  Y  L  G  T  V  A  A  R  L         p.1620

          .         .         .         .         .         .       g.145280
 AGAAAAGATGCTGTTACAAGCAAAATGGATCAAGGATCTATAGAACGCATTTTAAAACAG       c.4920
 R  K  D  A  V  T  S  K  M  D  Q  G  S  I  E  R  I  L  K  Q         p.1640

  | 25       .         .         .         .         .         .    g.147488
  | GTTTCAGGAGGGGAAGATGAAATCCAACAATTACAAAAAGCATTGCTTGATTACTTGGAT    c.4980
  | V  S  G  G  E  D  E  I  Q  Q  L  Q  K  A  L  L  D  Y  L  D      p.1660

          .         .         . | 26       .         .         .    g.148606
 GAAAACACTGAGACTGATCCTTCACTAGTG | TTTTCTCGTAAATTCTATATAGCCCAGTGG    c.5040
 E  N  T  E  T  D  P  S  L  V   | F  S  R  K  F  Y  I  A  Q  W      p.1680

          .         .         .         .         .         .       g.148666
 TTTCGAGACACAACTCTGGAAACAGAAAAAGCAATGAAATCACAAAAAGATGAAGAATCA       c.5100
 F  R  D  T  T  L  E  T  E  K  A  M  K  S  Q  K  D  E  E  S         p.1700

          .         .         .         .         .         .       g.148726
 TCTGAAGGAACACATCATGCAAAGGAAATTGAGACAACTGGCCAAATTATGCATCGAGCT       c.5160
 S  E  G  T  H  H  A  K  E  I  E  T  T  G  Q  I  M  H  R  A         p.1720

          .         .         .         .         .         .       g.148786
 GAAAACCGAAAAAAGTTTCTTAGAAGCATTATCAAAACCACACCTTCTCAGTTTAGCACA       c.5220
 E  N  R  K  K  F  L  R  S  I  I  K  T  T  P  S  Q  F  S  T         p.1740

       | 27  .         .         .         .         .         .    g.148947
 TTAAA | GATGAACTCTGATACTGTGGACTATGATGATGCTTGCTTGATTGTTCGATACTTG    c.5280
 L  K  |  M  N  S  D  T  V  D  Y  D  D  A  C  L  I  V  R  Y  L      p.1760

          .         .         .         .         | 28         .    g.150180
 GCCTCCATGAGGCCGTTTGCCCAGAGCTTTGATATTTATTTGACACAG | ATCCTACGAGTT    c.5340
 A  S  M  R  P  F  A  Q  S  F  D  I  Y  L  T  Q   | I  L  R  V      p.1780

          .         .         .         .         .         .       g.150240
 CTTGGTGAAAATGCAATTGCTGTTCGAACAAAAGCCATGAAGTGTTTGTCTGAGGTTGTT       c.5400
 L  G  E  N  A  I  A  V  R  T  K  A  M  K  C  L  S  E  V  V         p.1800

          .         .        | 29.         .         .         .    g.150394
 GCTGTAGACCCCAGTATTCTAGCAAGG | CTTGATATGCAACGAGGTGTTCATGGACGATTG    c.5460
 A  V  D  P  S  I  L  A  R   | L  D  M  Q  R  G  V  H  G  R  L      p.1820

          .         .         .         .         .         .       g.150454
 ATGGATAATTCGACTAGTGTCCGAGAAGCAGCAGTAGAATTACTAGGTCGATTTGTCCTT       c.5520
 M  D  N  S  T  S  V  R  E  A  A  V  E  L  L  G  R  F  V  L         p.1840

          .         .         .         .         .     | 30   .    g.152708
 TGTCGACCTCAGCTTGCTGAACAGTATTATGATATGCTGATTGAAAGAATATTG | GATACT    c.5580
 C  R  P  Q  L  A  E  Q  Y  Y  D  M  L  I  E  R  I  L   | D  T      p.1860

          .         .         .         .         .         .       g.152768
 GGTATCAGTGTCAGGAAAAGAGTAATAAAGATTCTCAGAGACATTTGTATTGAACAACCA       c.5640
 G  I  S  V  R  K  R  V  I  K  I  L  R  D  I  C  I  E  Q  P         p.1880

          .         .         .         .         .         .       g.152828
 ACATTTCCAAAAATCACAGAAATGTGTGTAAAAATGATTCGCAGAGTCAATGATGAAGAG       c.5700
 T  F  P  K  I  T  E  M  C  V  K  M  I  R  R  V  N  D  E  E         p.1900

           | 31        .         .         .         .         .    g.154397
 GGCATTAAG | AAATTAGTAAATGAAACATTCCAGAAACTCTGGTTTACTCCAACTCCACAC    c.5760
 G  I  K   | K  L  V  N  E  T  F  Q  K  L  W  F  T  P  T  P  H      p.1920

          .         .         .         .         | 32         .    g.155488
 AATGACAAAGAAGCAATGACAAGGAAAATTTTAAACATTACCGATGTG | GTTGCAGCATGC    c.5820
 N  D  K  E  A  M  T  R  K  I  L  N  I  T  D  V   | V  A  A  C      p.1940

          .         .         .         .   | 33     .         .    g.164514
 AGAGATACTGGATATGACTGGTTTGAGCAACTGCTTCAAAAC | TTGTTGAAGTCCGAAGAG    c.5880
 R  D  T  G  Y  D  W  F  E  Q  L  L  Q  N   | L  L  K  S  E  E      p.1960

          .         .         .         .         .         .       g.164574
 GATTCCTCATATAAACCTGTGAAGAAAGCTTGTACTCAACTTGTTGATAACCTAGTTGAG       c.5940
 D  S  S  Y  K  P  V  K  K  A  C  T  Q  L  V  D  N  L  V  E         p.1980

          .         .         .  | 34      .         .         .    g.166748
 CACATTCTTAAATATGAGGAATCTCTAGCTG | ACTCTGACAATAAAGGTGTGAATTCTGGA    c.6000
 H  I  L  K  Y  E  E  S  L  A  D |   S  D  N  K  G  V  N  S  G      p.2000

          .         .         .         .         .         .       g.166808
 AGATTGGTAGCTTGCATAACCACTTTGTTCTTATTCAGCAAAATAAGACCCCAGCTCATG       c.6060
 R  L  V  A  C  I  T  T  L  F  L  F  S  K  I  R  P  Q  L  M         p.2020

          .         .         .         .         | 35         .    g.172476
 GTTAAACATGCAATGACTATGCAACCATACCTTACCACTAAATGTAGT | ACGCAAAATGAT    c.6120
 V  K  H  A  M  T  M  Q  P  Y  L  T  T  K  C  S   | T  Q  N  D      p.2040

          .         .         .         .         .         .       g.172536
 TTCATGGTTATCTGCAATGTTGCAAAAATCCTAGAGCTAGTTGTACCACTGATGGAGCAT       c.6180
 F  M  V  I  C  N  V  A  K  I  L  E  L  V  V  P  L  M  E  H         p.2060

          .         .         .         .         .         .       g.172596
 CCAAGTGAAACTTTTCTTGCCACTATTGAGGAAGATCTAATGAAGCTCATCATCAAATAT       c.6240
 P  S  E  T  F  L  A  T  I  E  E  D  L  M  K  L  I  I  K  Y         p.2080

           | 36        .         .         .         .         .    g.172804
 GGCATGACT | GTAGTGCAACATTGTGTGAGCTGTCTTGGAGCTGTTGTAAATAAAGTGACA    c.6300
 G  M  T   | V  V  Q  H  C  V  S  C  L  G  A  V  V  N  K  V  T      p.2100

          .         .         .         .    | 37    .         .    g.173577
 CAAAATTTTAAATTTGTGTGGGCTTGTTTCAATAGATACTATG | GTGCCATTTCAAAATTA    c.6360
 Q  N  F  K  F  V  W  A  C  F  N  R  Y  Y  G |   A  I  S  K  L      p.2120

          .         .         .         .         .         .       g.173637
 AAAAGTCAACACCAAGAGGACCCAAATAACACTTCACTTCTAACAAACAAACCAGCACTT       c.6420
 K  S  Q  H  Q  E  D  P  N  N  T  S  L  L  T  N  K  P  A  L         p.2140

          .         .         .         .         .         .       g.173697
 CTTAGATCCCTTTTCACCGTTGGAGCACTATGTCGGCATTTTGATTTTGATCTGGAAGAT       c.6480
 L  R  S  L  F  T  V  G  A  L  C  R  H  F  D  F  D  L  E  D         p.2160

          .         | 38         .         .         .         .    g.174268
 TTTAAAGGCAACAGCAAG | GTTAACATAAAAGATAAAGTACTTGAACTATTGATGTATTTT    c.6540
 F  K  G  N  S  K   | V  N  I  K  D  K  V  L  E  L  L  M  Y  F      p.2180

          .         .         .         .          | 39        .    g.176630
 ACAAAACACTCAGATGAAGAAGTACAAACAAAAGCTATCATTGGTCTAG | GATTTGCCTTT    c.6600
 T  K  H  S  D  E  E  V  Q  T  K  A  I  I  G  L  G |   F  A  F      p.2200

          .         .         .         .         .         .       g.176690
 ATTCAGCATCCAAGTCTAATGTTCGAGCAAGAAGTGAAGAATCTATATAATAATATTTTA       c.6660
 I  Q  H  P  S  L  M  F  E  Q  E  V  K  N  L  Y  N  N  I  L         p.2220

          .         .         .         .         .         .       g.176750
 TCTGATAAGAACTCCTCAGTCAATTTAAAAATACAAGTGTTAAAAAACCTCCAGACCTAC       c.6720
 S  D  K  N  S  S  V  N  L  K  I  Q  V  L  K  N  L  Q  T  Y         p.2240

          .         .         .         .    | 40    .         .    g.177245
 CTACAAGAAGAAGATACACGTATGCAGCAGGCAGATAGAGACT | GGAAGAAAGTTGCAAAA    c.6780
 L  Q  E  E  D  T  R  M  Q  Q  A  D  R  D  W |   K  K  V  A  K      p.2260

          .         .         .         .         .         .       g.177305
 CAGGAAGACTTAAAAGAAATGGGTGATGTTTCCTCAGGGATGAGTAGTTCCATCATGCAG       c.6840
 Q  E  D  L  K  E  M  G  D  V  S  S  G  M  S  S  S  I  M  Q         p.2280

          .         .         .         .         .         .       g.177365
 CTTTATCTCAAACAGGTGCTTGAGGCATTTTTTCACACCCAGTCAAGTGTACGCCACTTT       c.6900
 L  Y  L  K  Q  V  L  E  A  F  F  H  T  Q  S  S  V  R  H  F         p.2300

          .         .         .         .         .     | 41   .    g.179902
 GCCCTAAATGTCATTGCATTGACTCTAAATCAAGGTCTTATTCATCCAGTTCAG | TGTGTG    c.6960
 A  L  N  V  I  A  L  T  L  N  Q  G  L  I  H  P  V  Q   | C  V      p.2320

          .         .         .         .         .         .       g.179962
 CCATATTTAATTGCTATGGGCACAGACCCAGAACCTGCTATGCGGAACAAGGCTGATCAG       c.7020
 P  Y  L  I  A  M  G  T  D  P  E  P  A  M  R  N  K  A  D  Q         p.2340

          .         .         .         .   | 42     .         .    g.180501
 CAACTTGTGGAAATAGACAAAAAATATGCTGGATTCATTCAT | ATGAAAGCAGTGGCTGGT    c.7080
 Q  L  V  E  I  D  K  K  Y  A  G  F  I  H   | M  K  A  V  A  G      p.2360

          .         .         .         .         .         .       g.180561
 ATGAAGATGTCTTACCAGGTACAACAGGCAATCAACACATGCCTAAAAGATCCTGTAAGG       c.7140
 M  K  M  S  Y  Q  V  Q  Q  A  I  N  T  C  L  K  D  P  V  R         p.2380

          .         .         .         .         .         .       g.180621
 GGTTTCAGACAAGACGAGTCCTCTAGCGCTTTGTGTTCACACCTTTACTCCATGATCCGT       c.7200
 G  F  R  Q  D  E  S  S  S  A  L  C  S  H  L  Y  S  M  I  R         p.2400

          .         .         .         .         .         .       g.180681
 GGAAACCGCCAACACAGACGAGCCTTTCTTATTTCTTTACTCAACCTCTTTGATGACACA       c.7260
 G  N  R  Q  H  R  R  A  F  L  I  S  L  L  N  L  F  D  D  T         p.2420

     | 43    .         .         .         .         .         .    g.185360
 GCA | AAAACAGACGTGACTATGCTCTTGTATATAGCAGACAATCTAGCCTGTTTTCCATAC    c.7320
 A   | K  T  D  V  T  M  L  L  Y  I  A  D  N  L  A  C  F  P  Y      p.2440

          .         .         .         .         .         .       g.185420
 CAGACACAGGAAGAGCCGTTGTTTATAATGCATCATATAGACATTACACTCTCAGTTTCT       c.7380
 Q  T  Q  E  E  P  L  F  I  M  H  H  I  D  I  T  L  S  V  S         p.2460

          .         .         . | 44       .         .         .    g.187038
 GGTAGTAACCTACTGCAGTCATTCAAGGAG | TCTATGGTAAAGGACAAAAGGAAAGAGAGA    c.7440
 G  S  N  L  L  Q  S  F  K  E   | S  M  V  K  D  K  R  K  E  R      p.2480

          .         .         .         .         .         .       g.187098
 AAATCATCACCTAGTAAGGAAAATGAGTCAAGCGACAGTGAAGAAGAAGTTTCCAGGCCT       c.7500
 K  S  S  P  S  K  E  N  E  S  S  D  S  E  E  E  V  S  R  P         p.2500

          .         .         .         .         .         .       g.187158
 CGGAAGTCACGGAAACGTGTAGATTCAGATTCAGATTCAGATTCAGAAGACGATATAAAT       c.7560
 R  K  S  R  K  R  V  D  S  D  S  D  S  D  S  E  D  D  I  N         p.2520

          .         .         .         .         .         .       g.187218
 TCAGTGATGAAATGTTTGCCAGAAAATTCAGCTCCTTTAATCGAATTTGCAAATGTGTCC       c.7620
 S  V  M  K  C  L  P  E  N  S  A  P  L  I  E  F  A  N  V  S         p.2540

          .         .         .         .         .         .       g.187278
 CAGGGTATTTTATTACTTCTCATGTTAAAACAACATTTGAAGAATCTTTGTGGATTTTCT       c.7680
 Q  G  I  L  L  L  L  M  L  K  Q  H  L  K  N  L  C  G  F  S         p.2560

       | 45  .         .         .         .         .         .    g.189016
 GATAG | TAAAATTCAGAAGTACTCTCCATCTGAATCTGCAAAAGTATATGATAAAGCGATA    c.7740
 D  S  |  K  I  Q  K  Y  S  P  S  E  S  A  K  V  Y  D  K  A  I      p.2580

          .         .         .         .         .         .       g.189076
 AACCGAAAAACAGGAGTTCATTTTCATCCAAAACAAACACTGGACTTCCTGCGGAGTGAC       c.7800
 N  R  K  T  G  V  H  F  H  P  K  Q  T  L  D  F  L  R  S  D         p.2600

          .         .         .         .         .         .       g.189136
 ATGGCTAATTCCAAAATCACAGAAGAGGTGAAAAGGAGTATAGTAAAACAGTATCTAGAT       c.7860
 M  A  N  S  K  I  T  E  E  V  K  R  S  I  V  K  Q  Y  L  D         p.2620

  | 46       .         .         .         .         .         .    g.191967
  | TTCAAACTTCTCATGGAACATCTGGACCCTGATGAAGAAGAAGAAGAAGGGGAGGTTTCA    c.7920
  | F  K  L  L  M  E  H  L  D  P  D  E  E  E  E  E  G  E  V  S      p.2640

          .         .         .         .         .         .       g.192027
 GCTAGCACAAATGCTCGGAACAAAGCAATTACCTCACTGCTTGGAGGAGGCAGCCCTAAA       c.7980
 A  S  T  N  A  R  N  K  A  I  T  S  L  L  G  G  G  S  P  K         p.2660

          .         .         .         .         .         .       g.192087
 AATAATACAGCAGCAGAGACAGAAGATGATGAAAGTGATGGGGAGGATAGAGGAGGAGGC       c.8040
 N  N  T  A  A  E  T  E  D  D  E  S  D  G  E  D  R  G  G  G         p.2680

           | 47        .         .         .         .         .    g.192695
 ACTTCAGGG | TCATTGAGAAGGTCAAAACGAAATTCAGACTCTACGGAGTTGGCAGCACAG    c.8100
 T  S  G   | S  L  R  R  S  K  R  N  S  D  S  T  E  L  A  A  Q      p.2700

          .         .         .         .         .         .       g.192755
 ATGAATGAAAGTGTTGACGTCATGGATGTCATCGCTATTTGCTGTCCAAAGTACAAAGAT       c.8160
 M  N  E  S  V  D  V  M  D  V  I  A  I  C  C  P  K  Y  K  D         p.2720

          .         .         .         .         .         .       g.192815
 CGACCACAAATTGCAAGAGTAGTGCAGAAAACCAGCAGTGGCTTCAGTGTTCAGTGGATG       c.8220
 R  P  Q  I  A  R  V  V  Q  K  T  S  S  G  F  S  V  Q  W  M         p.2740

          .         .         .         .         .         .       g.192875
 GCAGGCTCCTACAGTGGCTCCTGGACTGAGGCTAAGCGCCGTGATGGCCGCAAACTGGTG       c.8280
 A  G  S  Y  S  G  S  W  T  E  A  K  R  R  D  G  R  K  L  V         p.2760

          .         .         .         .         .         .       g.192935
 CCTTGGGTAGACACTATTAAAGAGTCAGACATTATTTACAAAAAAATTGCTCTAACGAGT       c.8340
 P  W  V  D  T  I  K  E  S  D  I  I  Y  K  K  I  A  L  T  S         p.2780

          .         .         .         .         .         .       g.192995
 GCTAATAAGCTGACTAATAAAGTTGTTCAGACTTTACGATCCCTGTATGCCGCCAAGGAT       c.8400
 A  N  K  L  T  N  K  V  V  Q  T  L  R  S  L  Y  A  A  K  D         p.2800

          .                                                         g.193010
 GGGACTTCCAGCTAA                                                    c.8415
 G  T  S  S  X                                                      p.2804

          .         .         .         .         .         .       g.193070
 tgaatttgtacatgcagccaaatttacaggaatttttttaaaaggcagaaaaacttgaaa       c.*60

          .         .         .         .         .         .       g.193130
 taccaacattctggcaaaaaaaaatcagttttatgaagagtaagtggaacctgggatgca       c.*120

          .         .         .         .         .         .       g.193190
 ggaacaaaagaaggaaatgttgggcaaacatttttgtgggagctcccttcgctgttgtgc       c.*180

          .         .         .         .         .         .       g.193250
 agcagaaacagattctcagttcatttttactcccactgtattatagtttaacaaaaattg       c.*240

          .         .         .         .         .         .       g.193310
 tttatatcttggaaaaaaaactttctgtttaaaaaaaataaacaagtgaatgttggaaat       c.*300

          .         .         .         .         .         .       g.193370
 tagtctgttaatgttcttaataaagtgttcttggagtttaacctagcagcggatggcttt       c.*360

          .         .         .         .         .         .       g.193430
 ctttagcttagcccagtttccagggaagcattgttttttccaggctgtaaaatggcagaa       c.*420

          .         .         .         .         .         .       g.193490
 tctcctggatatataatttattctgttgaaaaaaaaaaaagcatgcagtatctatgacct       c.*480

          .         .         .         .         .         .       g.193550
 atctgcagaaggagtttttgtaaatgtagattttgatgtattaggtcaccctgaaaacaa       c.*540

          .         .         .         .         .         .       g.193610
 tacaagaaaagggatccccaggtaatctggtggagcgaatactgcaataaatttttttac       c.*600

          .         .         .         .         .         .       g.193670
 ttctctttgttacttgtctgtttccatttgaatttcttattgtaaaaatctgtttaaatc       c.*660

          .         .         .         .         .         .       g.193730
 catttatattattttacagtcttttatgtaaaatttattatatcactggttttcaaagca       c.*720

          .         .         .         .         .         .       g.193790
 aaacataaaatattgtttatacagtttgtataggctgacttctgaataattggtatctat       c.*780

          .         .         .         .         .         .       g.193850
 tattttcattcccataagagggtgtaaacaattaactccagggttttattgtatcctgca       c.*840

          .         .         .         .         .         .       g.193910
 atatttagtattaactatatatgatttagcactgtgccaaacacattttcaagagtacat       c.*900

          .         .                                               g.193937
 tttgatataaaaagaaactatagttta                                        c.*927

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Nipped-B homolog (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center