noggin (NOG) - coding DNA reference sequence

(used for variant description)

(last modified November 4, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_005450.4 in the NOG gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011958.1, covering NOG transcript NM_005450.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5045
                aaaccggtgccaacgtgcgcggacgccgccgccgccgccgccgct       c.-481

 .         .         .         .         .         .                g.5105
 ggagtccgccgggcagagccggccgcggagcccggagcaggcggagggaagtgcccctag       c.-421

 .         .         .         .         .         .                g.5165
 aaccagctcagccagcggcgcttgcacagagcggccggacgaagagcagcgagaggagga       c.-361

 .         .         .         .         .         .                g.5225
 ggggagagcggctcgtccacgcgccctgcgccgccgccggcccgggaaggcagcgaggag       c.-301

 .         .         .         .         .         .                g.5285
 ccggcgcctcccgcgccccgcggtcgccctggagtaatttcggatgcccagccgcggccg       c.-241

 .         .         .         .         .         .                g.5345
 ccttccccagtagacccgggagaggagttgcggccaacttgtgtgcctttcttccgcccc       c.-181

 .         .         .         .         .         .                g.5405
 ggtgggagccggcgctgcgcgaagggctctcccggcggctcatgctgccggccctgcgcc       c.-121

 .         .         .         .         .         .                g.5465
 tgcccagcctcgggtgagccgcctccggagagacgggggagcgcggcggcgccgcgggct       c.-61

 .         .         .         .         .         .                g.5525
 cggcgtgctctcctccggggacgcgggacgaagcagcagccccgggcgcgcgccagaggc       c.-1

          .         .         .         .         .         .       g.5585
 ATGGAGCGCTGCCCCAGCCTAGGGGTCACCCTCTACGCCCTGGTGGTGGTCCTGGGGCTG       c.60
 M  E  R  C  P  S  L  G  V  T  L  Y  A  L  V  V  V  L  G  L         p.20

          .         .         .         .         .         .       g.5645
 CGGGCGACACCGGCCGGCGGCCAGCACTATCTCCACATCCGCCCGGCACCCAGCGACAAC       c.120
 R  A  T  P  A  G  G  Q  H  Y  L  H  I  R  P  A  P  S  D  N         p.40

          .         .         .         .         .         .       g.5705
 CTGCCCCTGGTGGACCTCATCGAACACCCAGACCCTATCTTTGACCCCAAGGAAAAGGAT       c.180
 L  P  L  V  D  L  I  E  H  P  D  P  I  F  D  P  K  E  K  D         p.60

          .         .         .         .         .         .       g.5765
 CTGAACGAGACGCTGCTGCGCTCGCTGCTCGGGGGCCACTACGACCCAGGCTTCATGGCC       c.240
 L  N  E  T  L  L  R  S  L  L  G  G  H  Y  D  P  G  F  M  A         p.80

          .         .         .         .         .         .       g.5825
 ACCTCGCCCCCCGAGGACCGGCCCGGCGGGGGCGGGGGTGCAGCTGGGGGCGCGGAGGAC       c.300
 T  S  P  P  E  D  R  P  G  G  G  G  G  A  A  G  G  A  E  D         p.100

          .         .         .         .         .         .       g.5885
 CTGGCGGAGCTGGACCAGCTGCTGCGGCAGCGGCCGTCGGGGGCCATGCCGAGCGAGATC       c.360
 L  A  E  L  D  Q  L  L  R  Q  R  P  S  G  A  M  P  S  E  I         p.120

          .         .         .         .         .         .       g.5945
 AAAGGGCTAGAGTTCTCCGAGGGCTTGGCCCAGGGCAAGAAGCAGCGCCTAAGCAAGAAG       c.420
 K  G  L  E  F  S  E  G  L  A  Q  G  K  K  Q  R  L  S  K  K         p.140

          .         .         .         .         .         .       g.6005
 CTGCGGAGGAAGTTACAGATGTGGCTGTGGTCGCAGACATTCTGCCCCGTGCTGTACGCG       c.480
 L  R  R  K  L  Q  M  W  L  W  S  Q  T  F  C  P  V  L  Y  A         p.160

          .         .         .         .         .         .       g.6065
 TGGAACGACCTGGGCAGCCGCTTTTGGCCGCGCTACGTGAAGGTGGGCAGCTGCTTCAGT       c.540
 W  N  D  L  G  S  R  F  W  P  R  Y  V  K  V  G  S  C  F  S         p.180

          .         .         .         .         .         .       g.6125
 AAGCGCTCGTGCTCCGTGCCCGAGGGCATGGTGTGCAAGCCGTCCAAGTCCGTGCACCTC       c.600
 K  R  S  C  S  V  P  E  G  M  V  C  K  P  S  K  S  V  H  L         p.200

          .         .         .         .         .         .       g.6185
 ACGGTGCTGCGGTGGCGCTGTCAGCGGCGCGGGGGCCAGCGCTGCGGCTGGATTCCCATC       c.660
 T  V  L  R  W  R  C  Q  R  R  G  G  Q  R  C  G  W  I  P  I         p.220

          .         .         .                                     g.6224
 CAGTACCCCATCATTTCCGAGTGCAAGTGCTCGTGCTAG                            c.699
 Q  Y  P  I  I  S  E  C  K  C  S  C  X                              p.232

          .         .         .         .         .         .       g.6284
 aactcgggggccccctgcccgcacccggacacttgatcgatccccaccgacgccccctgc       c.*60

          .         .         .         .         .         .       g.6344
 accgcctccaaccagttccaccaccctctagcgagggttttcaatgaacttttttttttt       c.*120

          .         .         .         .         .         .       g.6404
 tttttttttttttttctgggctacagagacctagctttctggttcctgtaatgcactgtt       c.*180

          .         .         .         .         .         .       g.6464
 taactgtgtaggaatgtatatgtgtgtgtatatacggtcccagttttaatttacttatta       c.*240

          .         .         .         .         .         .       g.6524
 aaaggtcagtattatacgttaaaagttaccggcttctactgtatttttaaaaaaaagtaa       c.*300

          .         .         .         .         .         .       g.6584
 gcaaaagaaaaaaaaaagaacagagaaaagagagacttattctggttgttgctaataatg       c.*360

          .         .         .         .         .         .       g.6644
 ttaacctgctatttatattccagtgcccttcgcatggcgaagcaggggggaaaagttatt       c.*420

          .         .         .         .         .         .       g.6704
 tttttcttgaagtacaaagagacgggggaacttttgtagaggactttttaaaagctattt       c.*480

          .         .         .         .         .         .       g.6764
 tccattcttcggaaagtgttttggttttccttggacctcgaagaagctatagagttcaat       c.*540

          .         .         .         .         .         .       g.6824
 gttattttacagttattgtaaatatagagaacaaatggaatgactaatcattgtaaatta       c.*600

          .         .         .         .         .         .       g.6884
 agagtatctgctatttattctttataatatcccgtgtagtaaatgagaaagaagtgcaga       c.*660

                                                                    g.6892
 gcaggatt                                                           c.*668

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Noggin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.