NOP10 ribonucleoprotein (NOP10) - coding DNA reference sequence

(used for variant description)

(last modified October 26, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_018648.3 in the NOP10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011562.1, covering NOP10 transcript NM_018648.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 aggaaattgacgaacacgtgacgcggtc       c.-61

 .         .         .         .         .         .                g.5088
 gggcggaccactgcagactgagcggtggaccgaattgggaccgctggcttataagcgatc       c.-1

          .         .         .         .         .     | 02   .    g.6059
 ATGTTTCTCCAGTATTACCTCAACGAGCAGGGAGATCGAGTCTATACGCTGAAG | AAATTT    c.60
 M  F  L  Q  Y  Y  L  N  E  Q  G  D  R  V  Y  T  L  K   | K  F      p.20

          .         .         .         .         .         .       g.6119
 GACCCGATGGGACAACAGACCTGCTCAGCCCATCCTGCTCGGTTCTCCCCAGATGACAAA       c.120
 D  P  M  G  Q  Q  T  C  S  A  H  P  A  R  F  S  P  D  D  K         p.40

          .         .         .         .         .         .       g.6179
 TACTCTCGACACCGAATCACCATCAAGAAACGCTTCAAGGTGCTCATGACCCAGCAACCG       c.180
 Y  S  R  H  R  I  T  I  K  K  R  F  K  V  L  M  T  Q  Q  P         p.60

          .                                                         g.6194
 CGCCCTGTCCTCTGA                                                    c.195
 R  P  V  L  X                                                      p.64

          .         .         .         .         .         .       g.6254
 gggtcccttaaactgatgtcttttctgccacctgttacccctcggagactccgtaaccaa       c.*60

          .         .         .         .         .         .       g.6314
 actcttcggactgtgagccctgatgcctttttgccagccatactctttggcatccagtct       c.*120

          .         .         .         .         .         .       g.6374
 ctcgtggcgattgattatgcttgtgtgaggcaatcatggtggcatcacccataaagggaa       c.*180

          .         .         .         .         .         .       g.6434
 cacatttgacttttttttctcatattttaaattactacaagattattaaagataaaatga       c.*240

          .                                                         g.6446
 tttgaaaaactc                                                       c.*252

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The NOP10 ribonucleoprotein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.