nuclear receptor subfamily 0, group B, member 1 (NR0B1) - coding DNA reference sequence

(used for variant description)

(last modified January 25, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_000475.4 in the NR0B1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009814.1, covering NR0B1 transcript NM_000475.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5015
                                              cgggcgccgcgggcc       c.-1

          .         .         .         .         .         .       g.5075
 ATGGCGGGCGAGAACCACCAGTGGCAGGGCAGCATCCTCTACAACATGCTTATGAGCGCG       c.60
 M  A  G  E  N  H  Q  W  Q  G  S  I  L  Y  N  M  L  M  S  A         p.20

          .         .         .         .         .         .       g.5135
 AAGCAAACGCGCGCGGCTCCTGAGGCTCCAGAGACGCGGCTGGTGGATCAGTGCTGGGGC       c.120
 K  Q  T  R  A  A  P  E  A  P  E  T  R  L  V  D  Q  C  W  G         p.40

          .         .         .         .         .         .       g.5195
 TGTTCGTGCGGCGATGAGCCCGGGGTGGGCAGAGAGGGGCTGCTGGGCGGGCGGAACGTG       c.180
 C  S  C  G  D  E  P  G  V  G  R  E  G  L  L  G  G  R  N  V         p.60

          .         .         .         .         .         .       g.5255
 GCGCTCCTGTACCGCTGCTGCTTTTGCGGTAAAGACCACCCACGGCAGGGCAGCATCCTC       c.240
 A  L  L  Y  R  C  C  F  C  G  K  D  H  P  R  Q  G  S  I  L         p.80

          .         .         .         .         .         .       g.5315
 TACAGCATGCTGACGAGCGCAAAGCAAACGTACGCGGCACCGAAGGCGCCCGAGGCGACG       c.300
 Y  S  M  L  T  S  A  K  Q  T  Y  A  A  P  K  A  P  E  A  T         p.100

          .         .         .         .         .         .       g.5375
 CTGGGTCCGTGCTGGGGCTGTTCGTGCGGCTCTGATCCCGGGGTGGGCAGAGCGGGGCTT       c.360
 L  G  P  C  W  G  C  S  C  G  S  D  P  G  V  G  R  A  G  L         p.120

          .         .         .         .         .         .       g.5435
 CCGGGTGGGCGGCCCGTGGCACTCCTGTACCGCTGCTGCTTTTGTGGTGAAGACCACCCG       c.420
 P  G  G  R  P  V  A  L  L  Y  R  C  C  F  C  G  E  D  H  P         p.140

          .         .         .         .         .         .       g.5495
 CGGCAGGGCAGCATCCTCTACAGCTTGCTCACTAGCTCAAAGCAAACGCACGTGGCTCCG       c.480
 R  Q  G  S  I  L  Y  S  L  L  T  S  S  K  Q  T  H  V  A  P         p.160

          .         .         .         .         .         .       g.5555
 GCAGCGCCCGAGGCACGGCCAGGGGGCGCGTGGTGGGACCGCTCCTACTTCGCGCAGAGG       c.540
 A  A  P  E  A  R  P  G  G  A  W  W  D  R  S  Y  F  A  Q  R         p.180

          .         .         .         .         .         .       g.5615
 CCAGGGGGTAAAGAGGCGCTACCAGGCGGGCGGGCCACGGCGCTTCTGTACCGCTGCTGC       c.600
 P  G  G  K  E  A  L  P  G  G  R  A  T  A  L  L  Y  R  C  C         p.200

          .         .         .         .         .         .       g.5675
 TTTTGCGGTGAAGACCACCCGCAGCAGGGCAGCACCCTCTACTGCGTGCCCACGAGCACA       c.660
 F  C  G  E  D  H  P  Q  Q  G  S  T  L  Y  C  V  P  T  S  T         p.220

          .         .         .         .         .         .       g.5735
 AATCAAGCGCAGGCGGCTCCGGAGGAGCGGCCGAGGGCCCCCTGGTGGGACACCTCCTCT       c.720
 N  Q  A  Q  A  A  P  E  E  R  P  R  A  P  W  W  D  T  S  S         p.240

          .         .         .         .         .         .       g.5795
 GGTGCGCTGCGGCCGGTGGCGCTCAAGAGTCCACAGGTGGTCTGCGAGGCAGCCTCAGCG       c.780
 G  A  L  R  P  V  A  L  K  S  P  Q  V  V  C  E  A  A  S  A         p.260

          .         .         .         .         .         .       g.5855
 GGCCTGTTGAAGACGCTGCGCTTCGTCAAGTACTTGCCCTGCTTCCAGGTGCTGCCCCTG       c.840
 G  L  L  K  T  L  R  F  V  K  Y  L  P  C  F  Q  V  L  P  L         p.280

          .         .         .         .         .         .       g.5915
 GACCAGCAGCTGGTGCTGGTGCGCAACTGCTGGGCGTCCCTGCTCATGCTTGAGCTGGCC       c.900
 D  Q  Q  L  V  L  V  R  N  C  W  A  S  L  L  M  L  E  L  A         p.300

          .         .         .         .         .         .       g.5975
 CAGGACCGCTTGCAGTTCGAGACTGTGGAAGTCTCGGAGCCCAGCATGCTGCAGAAGATC       c.960
 Q  D  R  L  Q  F  E  T  V  E  V  S  E  P  S  M  L  Q  K  I         p.320

          .         .         .         .         .         .       g.6035
 CTCACCACCAGGCGGCGGGAGACCGGGGGCAACGAGCCACTGCCCGTGCCCACGCTGCAG       c.1020
 L  T  T  R  R  R  E  T  G  G  N  E  P  L  P  V  P  T  L  Q         p.340

          .         .         .         .         .         .       g.6095
 CACCATTTGGCACCGCCGGCGGAGGCCAGGAAGGTGCCCTCCGCCTCCCAGGTCCAAGCC       c.1080
 H  H  L  A  P  P  A  E  A  R  K  V  P  S  A  S  Q  V  Q  A         p.360

          .         .         .         .         .         .       g.6155
 ATCAAGTGCTTTCTTTCCAAATGCTGGAGTCTGAACATCAGTACCAAGGAGTACGCCTAC       c.1140
 I  K  C  F  L  S  K  C  W  S  L  N  I  S  T  K  E  Y  A  Y         p.380

          .         .         | 02         .         .         .    g.9587
 CTCAAGGGGACCGTGCTCTTTAACCCGG | ACGTGCCGGGCCTGCAGTGCGTGAAGTACATT    c.1200
 L  K  G  T  V  L  F  N  P  D |   V  P  G  L  Q  C  V  K  Y  I      p.400

          .         .         .         .         .         .       g.9647
 CAGGGACTCCAGTGGGGAACTCAGCAAATACTCAGTGAACACACCAGGATGACGCACCAA       c.1260
 Q  G  L  Q  W  G  T  Q  Q  I  L  S  E  H  T  R  M  T  H  Q         p.420

          .         .         .         .         .         .       g.9707
 GGGCCCCATGACAGATTCATCGAACTTAATAGTACCCTTTTCCTGCTGAGATTCATCAAT       c.1320
 G  P  H  D  R  F  I  E  L  N  S  T  L  F  L  L  R  F  I  N         p.440

          .         .         .         .         .         .       g.9767
 GCCAATGTCATTGCTGAACTGTTCTTCAGGCCCATCATCGGCACAGTCAGCATGGATGAT       c.1380
 A  N  V  I  A  E  L  F  F  R  P  I  I  G  T  V  S  M  D  D         p.460

          .         .         .                                     g.9800
 ATGATGCTGGAAATGCTCTGTACAAAGATATAA                                  c.1413
 M  M  L  E  M  L  C  T  K  I  X                                    p.470

          .         .         .         .         .         .       g.9860
 agtcatgtgggccacacaagtgcagtagtgcagttcaccatgagggaagaataaagagct       c.*60

          .         .         .         .         .         .       g.9920
 gtgggcaaaagagtgtaaaatattttaaaataaactttcttaatatttttacatgcagag       c.*120

          .         .         .                                     g.9957
 tatttttgtattcaattaaagaaataattttattcca                              c.*157

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Nuclear receptor subfamily 0, group B, member 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center