neural retina leucine zipper (NRL) - coding DNA reference sequence

(used for variant description)

(last modified June 16, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_006177.3 in the NRL gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011697.1, covering NRL transcript NM_006177.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5011
                                                  gctgagcagag       c.-121

 .         .         .         .         .         .                g.5071
 gcaccaggccctgctccatggagccttcagtctcctgggaagctgtgcctgtctggctct       c.-61

 .         .         .         .   | 02     .         .             g.6775
 ggcactgaccacatcctctcggccatttctgaa | gtgcactcctcccagcccagctccaga    c.-1

          .         .         .         .         .         .       g.6835
 ATGGCCCTGCCCCCCAGCCCCCTGGCCATGGAATATGTCAATGACTTTGACTTGATGAAG       c.60
 M  A  L  P  P  S  P  L  A  M  E  Y  V  N  D  F  D  L  M  K         p.20

          .         .         .         .         .         .       g.6895
 TTTGAGGTAAAGCGGGAACCCTCTGAGGGCCGACCTGGCCCCCCTACAGCCTCACTGGGC       c.120
 F  E  V  K  R  E  P  S  E  G  R  P  G  P  P  T  A  S  L  G         p.40

          .         .         .         .         .         .       g.6955
 TCCACACCTTACAGCTCAGTGCCTCCTTCACCCACCTTCAGTGAACCAGGCATGGTGGGG       c.180
 S  T  P  Y  S  S  V  P  P  S  P  T  F  S  E  P  G  M  V  G         p.60

          .         .         .         .         .         .       g.7015
 GCAACCGAGGGCACCCGGCCAGGCCTGGAGGAGCTGTACTGGCTGGCTACCCTGCAGCAG       c.240
 A  T  E  G  T  R  P  G  L  E  E  L  Y  W  L  A  T  L  Q  Q         p.80

          .         .         .         .         .         .       g.7075
 CAGCTGGGGGCTGGGGAGGCATTGGGGCTGAGTCCTGAAGAGGCCATGGAGCTGCTGCAG       c.300
 Q  L  G  A  G  E  A  L  G  L  S  P  E  E  A  M  E  L  L  Q         p.100

          .         .         .         .         .         .       g.7135
 GGTCAGGGCCCAGTCCCTGTTGATGGGCCCCATGGCTACTACCCAGGGAGCCCAGAGGAG       c.360
 G  Q  G  P  V  P  V  D  G  P  H  G  Y  Y  P  G  S  P  E  E         p.120

          .         .  | 03      .         .         .         .    g.8094
 ACAGGAGCCCAGCACGTCCAG | CTGGCAGAGCGGTTTTCCGACGCGGCGCTGGTCTCGATG    c.420
 T  G  A  Q  H  V  Q   | L  A  E  R  F  S  D  A  A  L  V  S  M      p.140

          .         .         .         .         .         .       g.8154
 TCTGTGCGGGAGCTAAACCGGCAGCTGCGGGGCTGCGGGCGCGACGAGGCGCTGCGGCTG       c.480
 S  V  R  E  L  N  R  Q  L  R  G  C  G  R  D  E  A  L  R  L         p.160

          .         .         .         .         .         .       g.8214
 AAGCAGAGGCGCCGCACGCTGAAGAACCGCGGCTACGCGCAGGCCTGTCGCTCCAAGCGG       c.540
 K  Q  R  R  R  T  L  K  N  R  G  Y  A  Q  A  C  R  S  K  R         p.180

          .         .         .         .         .         .       g.8274
 CTGCAGCAGCGGCGCGGGCTGGAGGCCGAGCGCGCCCGCCTGGCCGCCCAGCTGGACGCG       c.600
 L  Q  Q  R  R  G  L  E  A  E  R  A  R  L  A  A  Q  L  D  A         p.200

          .         .         .         .         .         .       g.8334
 CTGCGGGCCGAGGTGGCCCGCCTGGCCCGGGAGCGCGATCTCTACAAGGCTCGCTGTGAC       c.660
 L  R  A  E  V  A  R  L  A  R  E  R  D  L  Y  K  A  R  C  D         p.220

          .         .         .         .         .                 g.8388
 CGGCTAACCTCGAGCGGCCCCGGGTCCGGGGACCCCTCCCACCTCTTCCTCTGA             c.714
 R  L  T  S  S  G  P  G  S  G  D  P  S  H  L  F  L  X               p.237

          .         .         .         .         .         .       g.8448
 gccgttcagagcaccttgtggtgtagtgggggctgggtggggtggctccgcccaggaggc       c.*60

          .         .         .         .         .         .       g.8508
 ggctgcacggttctctgcatcgttaccagagcgccttctggtcctagccacgccctgtat       c.*120

          .         .         .         .         .         .       g.8568
 gaccgcgcaaatatccccaaagcttttgggtcctcaagtcatgcccgaatttagatgctg       c.*180

          .         .         .         .         .         .       g.8628
 gtcattttctggagaggggtcccctccccttacgaacacagaaacccagcccacatgact       c.*240

          .         .         .         .         .         .       g.8688
 agcacgctgagctctgcagggaccagtgccaggcactggggggtggaagtgtggtgacac       c.*300

          .         .         .         .         .         .       g.8748
 agtgaatgggaggtggaggagggttgcagctcccacctcagtttagtttttaattcaggg       c.*360

          .         .         .         .         .         .       g.8808
 ttttcaacctgtaacacattaaagctgtaattagcaatgaggctgtattttcattctgaa       c.*420

          .         .         .         .         .         .       g.8868
 gcttgtaacctccccattttagcactacagaattttcaagatttcaatatccaacaacta       c.*480

          .         .         .         .         .         .       g.8928
 gatagattaggacctctatccgagatgctttttccctgcccaaccctgtggccttcaggg       c.*540

          .         .         .         .         .         .       g.8988
 ctcagagcagcaaaggcctgaagagtgagctctgggggttgttggtgtgggttgggagag       c.*600

          .         .         .         .         .         .       g.9048
 agctgtgtgcagaagtctggaaacctgggtcctagtcccagctcttccatgggatccccc       c.*660

          .         .         .         .         .         .       g.9108
 tgtcaccctgagcaaatcagttgcttcctggacttgtgttacttcatctaattctcatgt       c.*720

          .         .         .         .         .         .       g.9168
 ggattggacgacttctgctccctttccagttctggcatctccccagtatggaagtcccgg       c.*780

          .         .         .         .         .         .       g.9228
 tggtctccccaagaagtccccaagacaatctcgccaaaggcacctcctatcctgctgcag       c.*840

          .         .         .         .         .         .       g.9288
 tttcccagctgcagcctaggcaggggatgcacagcccaggcgaggaagcctggcttctct       c.*900

          .         .         .         .         .         .       g.9348
 gtgagcacatacgtgggtcctcggcagctccctccaggctgtctgggcctccagacctgc       c.*960

          .         .         .         .         .         .       g.9408
 acagggtgctcctgccacctcccacctctctgagggctgaggtgagacttctcctgggat       c.*1020

          .         .         .         .         .         .       g.9468
 gacaatttgctgagagagtgcagcttttgtgaattaaacttgaagtccaggcagaattct       c.*1080

          .         .         .         .                           g.9517
 aatgcaataagctaaatgttcttgcaatttaagaagtgttcattcttta                  c.*1129

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Neural retina leucine zipper protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.