NMDA receptor synaptonuclear signaling and neuronal migration factor (NSMF) - 776 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.8006
gtgagtcttgtgcccacgacttggggtcagggttgggtggtctctttctgctgctcagga  c.704+60

         .         .         .         .         .         .  g.8066
aacagcactttttcccagtctctgggcctaccaggggggctgcttctgaacagacccacg  c.704+120

         .         .         .         .         .         .  g.8126
tgcctatgctgtgccaggcctgccagggaggccagggctgactgctcttcccctcccatg  c.704+180

         .         .         .         .         .         .  g.8186
gctggtgcccagcccccccccccacacacacacagtcaggggacctggcccagggctgca  c.704+240

         .         .         .         .         .         .  g.8246
gctgatgagctctcagtggggtgtggggtgtggcaggttctcctgctcctatccactctc  c.704+300

         .         .         .         .         .         .  g.8306
ctcagcctgtgtctgccctccctcaaaccccaaatagaagcctacttctgtttcatacgt  c.704+360

         .         .          g.8334
gccataggtcatcacagtttcagggtcc  c.704+388

--------------------- middle of intron ---------------------
                     g.8335             .         .           g.8362
                     c.705-388  ccgcagggacctgctcctctctgtcttg  c.705-361

.         .         .         .         .         .           g.8422
acatacatttggcttttctgttctgggattccttccagggaagttccctttgctgcattg  c.705-301

.         .         .         .         .         .           g.8482
gtccccacaccaaagaagtgtcctgcccgggggagtccaccccacacccagcctcaggct  c.705-241

.         .         .         .         .         .           g.8542
gcctggtctcagcaaccagtccttgtggcatgggctgcagtgacatcagcttccgttgcc  c.705-181

.         .         .         .         .         .           g.8602
cattcagggctggccagcagtgtagccagcatcctgctggtggctgggttacctgtgagg  c.705-121

.         .         .         .         .         .           g.8662
gacctattgggtcagtgacaagaagggaactgtagggaccgggtgggggctgaggggagg  c.705-61

.         .         .         .         .         .           g.8722
cccggggttgagctcactgtgtcttctctctcacgccatcccttctggccctggcttcag  c.705-1


Powered by LOVD v.3.0 Build 24c
©2004-2020 Leiden University Medical Center