obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 440 nt intron 103 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.167139
gtgagtatcagggtcagccccacactatgcagggggagcctgaggccaacaggggcaggg  c.23037+60

         .         .         .         .         .         .  g.167199
cctctgggcaacagggcatgtgagcacagaactgtggctgtggcccgacctctgcccagc  c.23037+120

         .         .         .         .         .         .  g.167259
ccagaggacgtttgtccctgtgcgttagtgagagggctgtgggaacctcaggctggaacc  c.23037+180

         .         .         .         .  g.167299
acatttcagtgccccagcccccaacccccagcaggaggca  c.23037+220

--------------------- middle of intron ---------------------
       g.167300     .         .         .         .           g.167339
       c.23038-220  gggagaactgcaaggagctcagggacagggggtcgctgtc  c.23038-181

.         .         .         .         .         .           g.167399
acctctgacctctggcctttgccatctgccccacctggacatcttgggtgagggctgtgg  c.23038-121

.         .         .         .         .         .           g.167459
tgtcctggatccagggaatcccagggctggggctgcccagaagggcttccatcatgggag  c.23038-61

.         .         .         .         .         .           g.167519
gggcccctatcagggcaccatggtctccctgccatgtggctgcccacctcggtctcccag  c.23038-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center