obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 301 nt intron 106 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.170913
gtgagcaggcccaacacagagaccaggccccactgcctctcagggtcccaccagcgtggc  c.25255+60

         .         .         .         .         .         .  g.170973
cagaccggtggggagcaagcttgcactcacatgggtgcgggaacagatgaggggtcctgg  c.25255+120

         .         .         .   g.171004
tgggtgtagtgaactgagcagtcttggagga  c.25255+151

--------------------- middle of intron ---------------------
                 g.171005     .         .         .           g.171034
                 c.25256-150  cttcctggaggaggtgatggtggtacagat  c.25256-121

.         .         .         .         .         .           g.171094
gggccaggctggggagttggcagtggtggggcagggctcctcctggtgtctccagggtcc  c.25256-61

.         .         .         .         .         .           g.171154
aggccatgctctggggcctggaggtcacccctgaaggctgacctcaccctccctcctcag  c.25256-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center