obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 376 nt intron 32 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.76345
gtgagcactcccgccccggtgggtggacgtggggcagagccacaagaggacaaggttcag  c.8683+60

         .         .         .         .         .         .  g.76405
ggctgttgggaggcctggacagggctgtgggtgggtacagggcagggccatgggaggaga  c.8683+120

         .         .         .         .         .         .  g.76465
aggctcagggcagtgacaacacagttcagggccacagatggatatcaattagggccaggg  c.8683+180

          g.76473
gaggacac  c.8683+188

--------------------- middle of intron ---------------------
                                        g.76474               g.76481
                                        c.8684-188  agttcagg  c.8684-181

.         .         .         .         .         .           g.76541
actgcagaggacacagctcagggccaggggaagacatagttcagggaatggtggacacag  c.8684-121

.         .         .         .         .         .           g.76601
ctcagggccaggggcggacacagttcaaggccataggtgagcaggctcagggcttggcag  c.8684-61

.         .         .         .         .         .           g.76661
gcagggcagggtgattggttcctgtggtgccgtggcccagcctctccccactccctgcag  c.8684-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center