obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 1136 nt intron 35 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.77697
gtgtgtggctgcaggcacggcagagctcagggaagggaggcgtgctgggtgggcatggat  c.9484+60

         .         .         .         .         .         .  g.77757
gtggggccagccactacctgggtggcccacatcattctctgagattgaagggctgctctg  c.9484+120

         .         .         .         .         .         .  g.77817
ctgagccggggaggtcaggggagccttctgggggagccatggcttgatgtggtcctgtga  c.9484+180

         .         .         .         .         .         .  g.77877
ggcctgggtgcaagcaggtggacccggggacagtgggtcccggagccagaaattgtcccc  c.9484+240

         .         .         .         .         .         .  g.77937
ggagccagggttggaggctgtgctgtccctgcccgctggtcccgacgacatagcctgggg  c.9484+300

         .         .         .         .         .         .  g.77997
atgttgccctgtaccaggggacgtgtctgcatggaagtcatcaggccactgtggggacac  c.9484+360

         .         .         .         .         .         .  g.78057
cagtggggatagccagggagaagccgagatgccaggcaggggctgtgagtaggccacgtc  c.9484+420

         .         .         .         .         .         .  g.78117
tctgtccttcacggggccccagcaaggccctaaggccactgggctggcagggtagagcca  c.9484+480

         .         .         .         .         .         .  g.78177
tccctgaacccagccctgcagccttgggggcgtgcgtgccctggaacctgtcctgctttt  c.9484+540

         .         .          g.78205
caggggaagttccctcaactgcagggtg  c.9484+568

--------------------- middle of intron ---------------------
                    g.78206             .         .           g.78233
                    c.9485-568  gctacctggccccctctgtgtgtgtgcc  c.9485-541

.         .         .         .         .         .           g.78293
cggtcccagtggcatcctggtgtgggtgacaggtggtgtaaccagcctgtttgctggtcc  c.9485-481

.         .         .         .         .         .           g.78353
ttgacagtcttgtaacgagatgggaaggggcaggaggcatggtgagtttgtcctggagct  c.9485-421

.         .         .         .         .         .           g.78413
gggactagcctgcctggaggcccctcatccggggtcctgtgcctcctctcctccctgtga  c.9485-361

.         .         .         .         .         .           g.78473
tgaccatgggttctccctctccctgccacactgattggatcagagctgttggttatgcag  c.9485-301

.         .         .         .         .         .           g.78533
atgccaggggcagccagctccagcagaggggcatctactcattggctggtgcaatgtggc  c.9485-241

.         .         .         .         .         .           g.78593
accctgtcccccagggcctggcctctcccagggtctggcacctcccagggtttggtccct  c.9485-181

.         .         .         .         .         .           g.78653
gtggggtctggtccctctaaggaatccagctcctcctggcgtctggtccctgtgggctct  c.9485-121

.         .         .         .         .         .           g.78713
gatccctcctagggtctggtcccttgggctctgatccctcccagggtctggcccttccta  c.9485-61

.         .         .         .         .         .           g.78773
ggtctggcccagggcagtgctgtcctcttgcctggcctgacagtctctgatggcccgcag  c.9485-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center