obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 422 nt intron 39 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.83251
gtgggttgcatgcccgcattgcacatgttgctcagagctgcagacaggtggagaggtgga  c.10564+60

         .         .         .         .         .         .  g.83311
tggcagctcagccatgtgcccagtatccctgggctcacagagaaagcaccattggcttac  c.10564+120

         .         .         .         .         .         .  g.83371
tgtggggtgggggctcggaaggctgaattgggctctttcaggatggatgcttctgcatgg  c.10564+180

         .         .         .   g.83402
tttgcagaactgtgcttggcgtggcccgagc  c.10564+211

--------------------- middle of intron ---------------------
                g.83403       .         .         .           g.83433
                c.10565-211  caggctgcatccccactggggcaggagccgc  c.10565-181

.         .         .         .         .         .           g.83493
acggagcctgccctgttccctctgcagccttttgcgtggccccagcgtgagggtggctgg  c.10565-121

.         .         .         .         .         .           g.83553
tgggtgctgagccagggtgttgcctggtctgcagtgagacccagggtttctccccgttgg  c.10565-61

.         .         .         .         .         .           g.83613
cccctccagcggcagcacgacaggatcccacatgctcctgcttctctctctgtcccccag  c.10565-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center