obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 654 nt intron 40 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.83940
gtgagccccagcagccccaaagcccagccacaggccaggtgcctatagctctcttctcag  c.10831+60

         .         .         .         .         .         .  g.84000
gcagcaccgtcttcagggcagggcatgtgcgcccacaaggagcccaaggcaggagcaccc  c.10831+120

         .         .         .         .         .         .  g.84060
aggctcccgtacatcctgtatggggcacccatggctccccatgtccttcctggctctccc  c.10831+180

         .         .         .         .         .         .  g.84120
tggcaccttgtccaccctgctcggcttccgccctggcctctgccacctgcaggagccgcc  c.10831+240

         .         .         .         .         .         .  g.84180
ccgcagagctgtctcctctgcgtccctgaggggacgttccctctgtgcatgcctgtgtcc  c.10831+300

         .         .         g.84207
ctgacctcccatcttaggaggtgccag  c.10831+327

--------------------- middle of intron ---------------------
                    g.84208             .         .           g.84234
                    c.10832-327  ccacagtggcttagggcccaccgtgac  c.10832-301

.         .         .         .         .         .           g.84294
ctcatttgaccttactttcctcatcacagccacgctttgaggtctgggctagggcttcca  c.10832-241

.         .         .         .         .         .           g.84354
actgtgaatttggcgggcacaggtccctgacaccccactcttctgttctcctgcttggtt  c.10832-181

.         .         .         .         .         .           g.84414
caccctttctatccctcaccctcagagctgcccctttccagaagtctcaaggtcgctgcc  c.10832-121

.         .         .         .         .         .           g.84474
acaggccccaaaggagaagggggaccctgcagctgatgtccccagccctccaccacctat  c.10832-61

.         .         .         .         .         .           g.84534
aggggacccctagtggacttcagtcgggggagggcaagctgagcctgtgcctgtctgcag  c.10832-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center