obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 300 nt intron 42 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.85225
gtaagaccgtgtatccagagccgtgtccggtgtccaattttttacctctgctgtcagtcg  c.11362+60

         .         .         .         .         .         .  g.85285
tacccattctagtctaccctgactgtgccatgcccttcccagcacatcacggaatccctt  c.11362+120

         .         .         .  g.85315
ccagctttctgggctgtggaaggaaccagg  c.11362+150

--------------------- middle of intron ---------------------
                 g.85316      .         .         .           g.85345
                 c.11363-150  agaacccggcatttgcagccagactcccac  c.11363-121

.         .         .         .         .         .           g.85405
cctcgaggcaccctgggacctgtcctgtgggagtctgtcttatcctccgtcttgccatgg  c.11363-61

.         .         .         .         .         .           g.85465
cctgtccccctgtgcttcccagaatctgatctccatgtctgtctgtccatctctccccag  c.11363-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center