obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 715 nt intron 58 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.105284
gtagccacaggcgggccccaccagtgactgcatggggtgagaatgtctgggccctgctgg  c.15610+60

         .         .         .         .         .         .  g.105344
atacggagacatacggcaaaggttcctgcctttggaggctgggggcctggcagggaggtg  c.15610+120

         .         .         .         .         .         .  g.105404
gacctgtgagctggcatttcagggcggccctaggatgtcagaggagagtgggctgagcca  c.15610+180

         .         .         .         .         .         .  g.105464
ggctggtggggcaggttgtcttgggcttccagtaggctgacacagtgttggagtttgggt  c.15610+240

         .         .         .         .         .         .  g.105524
cttggcccttgcaggggggccacttcaaaccatagcccactcccagccctcagtcatctg  c.15610+300

         .         .         .         .         .          g.105582
caccatctcctctagttctcacactagtcccatttacccacctgtcatccatcctttc  c.15610+358

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.105639
   gttcatctgtttatccattcacccatccatccacccattcactatccatccatccat  c.15611-301

.         .         .         .         .         .           g.105699
catccatccattatccatcgatccatccacaatccatctatttatccactgatcagccat  c.15611-241

.         .         .         .         .         .           g.105759
ccatccatccacccattatccatccattcattcttccattgatccattcacccatccact  c.15611-181

.         .         .         .         .         .           g.105819
gtccattagagaagactctgcctgcaactggaatggggagctgagaacaggcccccatgt  c.15611-121

.         .         .         .         .         .           g.105879
gcatgtctttgtgcactaggggaggatacccagggatggactcctgggacgatgagactg  c.15611-61

.         .         .         .         .         .           g.105939
ggttgattgagggggcacctcagacgctgaggctgacacccatgcctcccctgtgtccag  c.15611-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center