obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 479 nt intron 62 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.113885
gtgggtggtgggcgagcttttccctcccctgcaggtcgggtctggggcgcgccccgcctc  c.16432+60

         .         .         .         .         .         .  g.113945
cagagcttgcgagtgcgtgggtgaccatcctgggctgggttctgcagcatctgcccactc  c.16432+120

         .         .         .         .         .         .  g.114005
cagagcctggggttgactgcctgcggatatgggcctgaccatgggagtctgggaggctgc  c.16432+180

         .         .         .         .         .         .  g.114065
tcttggccaggcataaccatgcatgagcctaccaccctgtggattcctaaggccaaggtc  c.16432+240

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.114124
 ccttcatcctgccccatctccccctcagctccccggactcctaatgcagatctgagccc  c.16433-181

.         .         .         .         .         .           g.114184
agctctggggagacaggaggtacagagactgccaggggctctccatgctgggtgggctct  c.16433-121

.         .         .         .         .         .           g.114244
gggcacatatagtctccatgtgacatgcacctgcagccagtatcagagcccagtggcttc  c.16433-61

.         .         .         .         .         .           g.114304
cagagggactgttggtgccgacagggagccacccccctgaccagtcccccttttccccag  c.16433-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center