obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 710 nt intron 64 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.115074
gtgcgttgtccctgtccttccaggttccagggtggggagctctggtgtgggggtgcagct  c.17002+60

         .         .         .         .         .         .  g.115134
tggccttcctctcacaggctctctcagggaagggctgagggtccttttgaggaccccatc  c.17002+120

         .         .         .         .         .         .  g.115194
acatgggagagactgaggctccacagggagatgcggcaaaccccatgttgcagagccttg  c.17002+180

         .         .         .         .         .         .  g.115254
atggcgtaggccaacctgcctgtccctgagcaggtcctgggtggtgcagcccttggttct  c.17002+240

         .         .         .         .         .         .  g.115314
cctattctggtccctttaagcttctgggcccctgcacacagacatcccctgtactctgaa  c.17002+300

         .         .         .         .         .       g.115369
ccccctgaaacccccggtgctctgatccctcccacactctgaggcctgttccctg  c.17002+355

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.115424
     aactctgagcctaatcctccctgcatggcagccagcacccccataagtctaggcg  c.17003-301

.         .         .         .         .         .           g.115484
ctctatcccagaagcagggccagaagggctcaaatcagcccaatttgcttttgcagagtc  c.17003-241

.         .         .         .         .         .           g.115544
ctttcctgttccggtcatcacataccctatgcagggaggtagactgaggcctcactcaaa  c.17003-181

.         .         .         .         .         .           g.115604
gtgggggagctgaggctcaggggctctgagacttgcaaagattgtgccatctgaagtagc  c.17003-121

.         .         .         .         .         .           g.115664
tagtgccaggtggggagagaggcctagcaaggccacagcccagctgcatactgataagca  c.17003-61

.         .         .         .         .         .           g.115724
gctgaggtctggggtgatggctctgaactagcccactgactagtcttttgccttcctcag  c.17003-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center