obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 260 nt intron 68 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.129839
gtaggggctgccagaggtgggctgtgccccatggactgacgtcgcagggcctctcgggga  c.18602+60

         .         .         .         .         .         .  g.129899
gtgatgctgctgggtgagggcagggcttggtctgacagcatccaatcctggagccttcct  c.18602+120

         .  g.129909
ccaggccctg  c.18602+130

--------------------- middle of intron ---------------------
                                     g.129910     .           g.129919
                                     c.18603-130  gcggtctctg  c.18603-121

.         .         .         .         .         .           g.129979
tccactcagtcagcaaacaggggcttccagcgtcatccatgcccaagcccctcagcaccc  c.18603-61

.         .         .         .         .         .           g.130039
ctcccgccctgctcccctcgatgccctgctttatggctgaccccttttctgttctgccag  c.18603-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center