obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 270 nt intron 71 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.131445
gtgaggcagccccagacaggcagggagaggccaggtggccatgggtgctgagggcctgag  c.18958+60

         .         .         .         .         .         .  g.131505
cctagggctggctgcagtggaggtgtgggtggccatgggctggctcagggagggcgcagc  c.18958+120

         .       g.131520
aaggagacagcccgg  c.18958+135

--------------------- middle of intron ---------------------
                                g.131521          .           g.131535
                                c.18959-135  ccgagggggaagcgt  c.18959-121

.         .         .         .         .         .           g.131595
ggtgctgtccaggtgctggctgtggagagccacctgggcgtctgcagacatcatccgggg  c.18959-61

.         .         .         .         .         .           g.131655
ccaggaggcgggcggtgggggctgtgccgaggtctctgccagccagcctgtgtcccctag  c.18959-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center