obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 492 nt intron 73 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.132199
gtgagtgggggtggggggatggggggatggggggctggggcatggggggtgggcactggg  c.19276+60

         .         .         .         .         .         .  g.132259
tggctttggggtctccttggggcacactgcccatcaccaccatcttggctgggaccctgt  c.19276+120

         .         .         .         .         .         .  g.132319
gggaccccctccttcctcttttcattctctgacagcaccagggagaccccaaaatgggtc  c.19276+180

         .         .         .         .         .         .  g.132379
aggccctggtggtgctggtggttttgagcctcagagtcgcctctgggcccaggccccgtg  c.19276+240

        g.132385
ggttct  c.19276+246

--------------------- middle of intron ---------------------
                                         g.132386             g.132391
                                         c.19277-246  gcaccg  c.19277-241

.         .         .         .         .         .           g.132451
ctggctccagagacatttcctgaagccccctgcatcctgggccttgcttagcccctctga  c.19277-181

.         .         .         .         .         .           g.132511
ggacaggaacccctgttctcctcccatcactgtcagggtgaccacgggccaagagtggga  c.19277-121

.         .         .         .         .         .           g.132571
tggggaggtgagctcgggcacagcccctgctcagggcttcggagggacccagtccagatc  c.19277-61

.         .         .         .         .         .           g.132631
tggaatcagatgtgctggggttgggagcaccgtctgatggcttgccggtcctcctgacag  c.19277-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center