obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 480 nt intron 79 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.135273
gtgagtgactgccgggccggaggtggtggcactggcatcccaccagctggacagtctccc  c.19955+60

         .         .         .         .         .         .  g.135333
aaagaagcaggccgcttgccctggctctgggtccaggacctaaccctggaggtcttgggg  c.19955+120

         .         .         .         .         .         .  g.135393
tcatggccatgctgattcctctgcgggggcctctgaaacagcgctcctgtgtgagcctgt  c.19955+180

         .         .         .         .         .         .  g.135453
tagggacgggtgggggccgaggacagcagagcaggcccagagctgcctgggttcccgcag  c.19955+240

--------------------- middle of intron ---------------------
.         .         .         .         .         .           g.135513
ctgccctcccagcctcgtgctggcaggacccatctgggtggcttcctgatgttggggccg  c.19956-181

.         .         .         .         .         .           g.135573
gccttgtccaagagggagcctctctccacctgctctcccacttcctgcgagcaggcaaca  c.19956-121

.         .         .         .         .         .           g.135633
ggctgcgcagcaggaggcgctcccatctagcagctgagggagtgggggcctcgtggccca  c.19956-61

.         .         .         .         .         .           g.135693
cagtccctgcacgggaagcaggagctccgtggtcccttacggcagccccctcctgcccag  c.19956-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center