obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 404 nt intron 81 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.137002
gtgcccatgcctgaactcatgggctcctgaacctcagtgcctgcccttggctccctttga  c.20286+60

         .         .         .         .         .         .  g.137062
aggctcactgagcccaggcgtcctccaaggttcatcctgttctgcccacatcagagcctg  c.20286+120

         .         .         .         .         .         .  g.137122
cgctcatcttccccgacctcgccactgcccacagcctccctgcaccccccttgggcctca  c.20286+180

         .         .    g.137144
gttcagaaatgcgggtggagct  c.20286+202

--------------------- middle of intron ---------------------
                         g.137145       .         .           g.137166
                         c.20287-202  gcttttgcagccctgtgcttct  c.20287-181

.         .         .         .         .         .           g.137226
gggaaggccacttcagcagcccaagtcctgtgcttgtcacctgtcaggaggtgatgacag  c.20287-121

.         .         .         .         .         .           g.137286
ctgtcacctggggtgtaggctgtgtgtgcaccctggggacccaccctccagctctcaggg  c.20287-61

.         .         .         .         .         .           g.137346
acacagccatcagtgggccttgcactcctgccctaaaacccaccctcctggttcccacag  c.20287-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center