obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 504 nt intron 85 reference sequence

(intronic numbering for coding DNA Reference Sequence)

         .         .         .         .         .         .  g.138515
gtgagtgtccaccttcccgggggcccaggtggctgagccaggatggggcacccggctgca  c.20905+60

         .         .         .         .         .         .  g.138575
gccgcacaggtccctgcctgggtgggtgtgaggggtgggctcgttcctgggacagacggc  c.20905+120

         .         .         .         .         .         .  g.138635
tacagcctcatggggagcccctgggctgggtgttgggttggccctgatccaaggtcgggg  c.20905+180

         .         .         .         .         .         .  g.138695
ataccatggggtccccaagctcaaggcacccatccggatcatgtcaggggctgtgaaggg  c.20905+240

         .    g.138707
tctggcagcccg  c.20905+252

--------------------- middle of intron ---------------------
                                   g.138708       .           g.138719
                                   c.20906-252  gggtctgcttcc  c.20906-241

.         .         .         .         .         .           g.138779
tcaaccagaacagaatcttcccccgagcccccactgctctccatttaacatgcacctgcc  c.20906-181

.         .         .         .         .         .           g.138839
tcactcacctgactccaggtggggaccttggatgaggggtgacaagggacagtccccata  c.20906-121

.         .         .         .         .         .           g.138899
ggggccacaccatcagatgtggggctcatggtgcagggcaggtgacctgccaggtgcacc  c.20906-61

.         .         .         .         .         .           g.138959
tgggggtgccgcagcccgatgtccccccacagagcactcagggctgttgtgtgtcctcag  c.20906-1