obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 2225 nt intron 91 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.159656
gtgaggcccagatgcatgctgatgacaaagacccccagggattgaccccaaccctggctg  c.21712+60

         .         .         .         .         .         .  g.159716
tgcaacatgaggggtgcccatcccatgggcattaactggccaggccccagtgaccccgat  c.21712+120

         .         .         .         .         .         .  g.159776
ttggaatcccagtggctccatgcactgggggtcctgggcaaagcctacctcttgcttggc  c.21712+180

         .         .         .         .         .         .  g.159836
ctcagtttccccatctgaatctggcacagaatgggttctggaaggttcctcctgctctaa  c.21712+240

         .         .         .         .         .         .  g.159896
atctgttccaggagccagaggcttcccatgcttggcctgtgatggccaattcaggtgccc  c.21712+300

         .         .         .         .         .         .  g.159956
tgtgctcctcagtggacagggaggagggggagcagggggtgagaaaggagaggaggagag  c.21712+360

         .         .         .         .         .         .  g.160016
agaggagaagagggagaggaggagaggggcagagggggaagaagacagaaaaggaggagg  c.21712+420

         .         .         .         .         .         .  g.160076
aggtggaggagggaggggcagaagcagccagtaccccagacagaccagaccaaactggct  c.21712+480

         .         .         .         .         .         .  g.160136
gctacaagagccagctctgtgggtcactcaagccctttcccccaggtgttatgatcacct  c.21712+540

         .         .         .         .         .         .  g.160196
aagccccttcccccaggtgttgggggtctcctgttatgaagcactttaacggcttttttg  c.21712+600

         .         .         .         .         .         .  g.160256
tctttggaacggggtctcactctgtcacctacgctggagtgcagtgtgcagggatacgac  c.21712+660

         .         .         .         .         .         .  g.160316
cacagctcactgcagcctcaacctcctgggtttaagcgattctctcacctcagcctccca  c.21712+720

         .         .         .         .         .         .  g.160376
agtagctgggactacaggttcatggcaccatgcccggctagcttttttatttttgggtag  c.21712+780

         .         .         .         .         .         .  g.160436
agatggggtattgctgtgttgcccaggctgctctcaaactcctgggctcaagcctttttc  c.21712+840

         .         .         .         .         .         .  g.160496
ctacctcagcttcccaaagtgctgggattacaggtgtgagcctggccaccaacctgctcg  c.21712+900

         .         .         .         .         .         .  g.160556
agccctggcctcgctccagcccagtcctcagctccctgatcaaggaccttttcctaaagg  c.21712+960

         .         .         .         .         .         .  g.160616
gacagatggtgcatctggggaaactgaggcctgggttgggggaaatctcatcccaggccc  c.21712+1020

         .         .         .         .         .         .  g.160676
tgctgctcaccgcaggtggatgggggccctggagtcaggcgtccagaaagccatgaggac  c.21712+1080

         .         .         .     g.160709
agggctggagcgaggccagagctagggcaggat  c.21712+1113

--------------------- middle of intron ---------------------
              g.160710        .         .         .           g.160741
              c.21713-1112  ggcagccagactcctcccctgccccgtccagc  c.21713-1081

.         .         .         .         .         .           g.160801
gtcctctgcatcctgcttgtgtaggcttctcgggtccatgcccttctccttctccttgtt  c.21713-1021

.         .         .         .         .         .           g.160861
tggcccagaccctgccttggttatcttcacacaaaggaccatcacggccttgcgtcctgc  c.21713-961

.         .         .         .         .         .           g.160921
gtgtctacccactctggtcaccccaccccatcttgcagggccttccctgatgcaccctcc  c.21713-901

.         .         .         .         .         .           g.160981
ccagccacccctacctggtcccatcaccttggagaaaggccgtcaggctggagccaagca  c.21713-841

.         .         .         .         .         .           g.161041
ggatgagacctccagggcacagccccccaccatggtctcacgcttaattccctaaacaca  c.21713-781

.         .         .         .         .         .           g.161101
tgctccaactggagtttccaacagtcccatagtccctgtgctgcttctgtggcctcccgc  c.21713-721

.         .         .         .         .         .           g.161161
agggccagggggcatagggttcggggcaagcaggccaccttcccccatgagatgagaggg  c.21713-661

.         .         .         .         .         .           g.161221
ccacccctcgggtctgctttcccacaacaggcacggaagcccccaggccttcaatgagct  c.21713-601

.         .         .         .         .         .           g.161281
caggctcctccctctagctgcctgggcaccctggggccacctagggccaaggggcgtccc  c.21713-541

.         .         .         .         .         .           g.161341
tctaggccccaccttggtgtacatttgctccgtgcacctatcacggggctggctgggtgc  c.21713-481

.         .         .         .         .         .           g.161401
agggcctggcccaggagaaggggcacagcatccctgtcaccctgggaagtggtctcttct  c.21713-421

.         .         .         .         .         .           g.161461
cattcttctggcctgtcacccttccccccgcagtgatcgagggctggtgtctgcaaggga  c.21713-361

.         .         .         .         .         .           g.161521
aggacaggtcaaggttggggcgggggtctgggaggactggccctgaccctcactctcact  c.21713-301

.         .         .         .         .         .           g.161581
ctgcctcctgggtggagtgcaccccgccacatccaatggcctgtgtgccagggccacagt  c.21713-241

.         .         .         .         .         .           g.161641
ggctgagcagacaaacctgccccaggtgccgtttggcccatcctgggcagatcgcgggct  c.21713-181

.         .         .         .         .         .           g.161701
ccttcacaggcctgacgctcgttcactctgtccgatgcctctgcagagtgggcatgggtt  c.21713-121

.         .         .         .         .         .           g.161761
gtcctgctctggccatgaccccacccaccctgcctgtggcaggcatccgtcccactcgtc  c.21713-61

.         .         .         .         .         .           g.161821
cacctgcttgaagctcacgtgtacccgactcctacagccacctgccctgtctcccagcag  c.21713-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center