obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) - 305 nt intron 99 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.165317
gttcgcatgtcctcacccctgcaccccagagcctggggcctgcaggccaggtggggcagg  c.22638+60

         .         .         .         .         .         .  g.165377
cccaccactcccagtctgagaggacttgcttgcctccagggacagggagctcaccacctc  c.22638+120

         .         .         .     g.165410
taggcagccctttcaggtggggcgtggctctgg  c.22638+153

--------------------- middle of intron ---------------------
               g.165411       .         .         .           g.165442
               c.22639-152  tggagcagaggctgtccccaaatggctgcacc  c.22639-121

.         .         .         .         .         .           g.165502
gggtgctccccactgtcccaccctgcccccgggcctctgggtgtccccaccaggcctatc  c.22639-61

.         .         .         .         .         .           g.165562
agccccaggagtcacccccttagggcacggctctcacccactcccaactctccccaacag  c.22639-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center