oocyte expressed protein (OOEP) - coding DNA reference sequence

(used for variant description)

(last modified November 11, 2024)

This file was created to facilitate the description of sequence variants on transcript NM_001080507.2 in the OOEP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering OOEP transcript NM_001080507.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 ATGGTCGATGATGCTGGTGCCGCTGAGTCCCAGCGGGGCAAACAGACTCCGGCCCACTCC       c.60
 M  V  D  D  A  G  A  A  E  S  Q  R  G  K  Q  T  P  A  H  S         p.20

          .         .         .         .         .         .       g.120
 CTGGAGCAGCTGCGTAGGTTACCACTTCCGCCGCCACAGATTCGCATCCGGCCCTGGTGG       c.120
 L  E  Q  L  R  R  L  P  L  P  P  P  Q  I  R  I  R  P  W  W         p.40

          .         .         .         .         .         .       g.180
 TTTCCGGTGCAGGAACTGAGAGACCCTTTGGTGTTCTACCTAGAGGCATGGCTGGCAGAC       c.180
 F  P  V  Q  E  L  R  D  P  L  V  F  Y  L  E  A  W  L  A  D         p.60

          . | 02       .         .         .         .         .    g.457
 GAGCTCTTTG | GCCCAGACCGAGCCATAATTCCAGAAATGGAGTGGACGAGCCAGGCCCTG    c.240
 E  L  F  G |   P  D  R  A  I  I  P  E  M  E  W  T  S  Q  A  L      p.80

          .         .         .         .         .         .       g.517
 CTGACAGTGGACATAGTTGACTCAGGGAACCTAGTCGAAATCACCGTTTTCGGGCGGCCC       c.300
 L  T  V  D  I  V  D  S  G  N  L  V  E  I  T  V  F  G  R  P         p.100

          .         .         .         .         .         .       g.577
 CGTGTACAGAATCGGGTGAAGAGCATGCTCCTGTGCCTGGCATGGTTTCACCGAGAACAT       c.360
 R  V  Q  N  R  V  K  S  M  L  L  C  L  A  W  F  H  R  E  H         p.120

          . | 03       .         .         .         .         .    g.979
 CGTGCCCGAG | CTGAGAAGATGAAACACCTTGAGAAGAACTTGAAGGCCCATGCATCAGAC    c.420
 R  A  R  A |   E  K  M  K  H  L  E  K  N  L  K  A  H  A  S  D      p.140

          .         .         .                                     g.1009
 CCCCACTCTCCCCAGGATCCTGTTGCTTAA                                     c.450
 P  H  S  P  Q  D  P  V  A  X                                       p.149

          .         .         .         .         .         .       g.1069
 gacaacatagttactgttgggaacatcttaactttctaacttttgctgctaaagttgaag       c.*60

          .         .         .         .         .         .       g.1129
 aaaagcaagtatagcattcttaaatccccgtattcctttttcctgtgtcttgatggattg       c.*120

          .         .         .         .         .         .       g.1189
 tggtttattttgttgcaagagtgagtttgaactattctaataaagaaatggctattttgc       c.*180

          .         .         .         .                           g.1238
 caaaagcattaagatcttcacacacttataataaagcaaatttataaaa                  c.*229

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Oocyte expressed protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.