optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) (OPA3) - coding DNA reference sequence

(used for variant description)

(last modified November 25, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_001017989.2 in the OPA3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_013332.1, covering OPA3 transcript NM_001017989.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5040
                     actgacgcacgcatggccacgagagggcgggggaggagtg       c.-61

 .         .         .         .         .         .                g.5100
 aagaggttgaggcgccccgcccagtcagcaaggttgcgcgtgccctgtgagaccgccaag       c.-1

          .         .         .         .         .         .       g.5160
 ATGGTGGTGGGCGCGTTCCCTATGGCGAAGCTGCTATACTTGGGCATCCGGCAGGTCAGC       c.60
 M  V  V  G  A  F  P  M  A  K  L  L  Y  L  G  I  R  Q  V  S         p.20

          .         .         .         .         .         .       g.5220
 AAGCCGCTTGCCAACCGTATTAAGGAGGCCGCCCGCCGAAGCGAGTTCTTCAAGACCTAT       c.120
 K  P  L  A  N  R  I  K  E  A  A  R  R  S  E  F  F  K  T  Y         p.40

          .         .   | 02     .         .         .         .    g.60446
 ATCTGCCTCCCGCCGGCTCAAC | TGTACCACTGGCTGGAGATGCGGACCAAAATGCGCATC    c.180
 I  C  L  P  P  A  Q  L |   Y  H  W  L  E  M  R  T  K  M  R  I      p.60

          .         .         .         .         .         .       g.60506
 ATGGGTTTCAATGCCGCTGCCATCAAGCCGCTGAACGAGGGTGCAGCCGCCGAGCTGGGC       c.240
 M  G  F  N  A  A  A  I  K  P  L  N  E  G  A  A  A  E  L  G         p.80

          .         .         .         .         .         .       g.60566
 GCGGAGCTGCTGGGCGAGGGCATCATCTTCATCACCGCCTGCAGCTGCCTGATGCTGGAG       c.300
 A  E  L  L  G  E  G  I  I  F  I  T  A  C  S  C  L  M  L  E         p.100

          .         .         .         .         .         .       g.60626
 TATTGGCGCCACCAGTTGCAGCAGCGCCGCAAGGAAAAGGAGCGACGTGTTGCCAGGGAG       c.360
 Y  W  R  H  Q  L  Q  Q  R  R  K  E  K  E  R  R  V  A  R  E         p.120

          .         .         .         .         .         .       g.60686
 GCGCTGCGGGGCGAGGTGGGCCACTTGGGGCTGGCGCTCGAGGAGTTGCAGGCGCAGGTG       c.420
 A  L  R  G  E  V  G  H  L  G  L  A  L  E  E  L  Q  A  Q  V         p.140

          .         .         .         .         .         .       g.60746
 CAGGCGACGTCGACGCAGCTCGCCCTGGAGGAGCTGCGCGCTCAGCTGCAGGAGGTGCGA       c.480
 Q  A  T  S  T  Q  L  A  L  E  E  L  R  A  Q  L  Q  E  V  R         p.160

          .         .         .         .         .         .       g.60806
 GCCCACCTCTGCCTCCGAGACCCGCCGCCTGCACCCCCAGTTGCGCCGGCGTCCGAGAAA       c.540
 A  H  L  C  L  R  D  P  P  P  A  P  P  V  A  P  A  S  E  K         p.180

                                                                    g.60809
 TAG                                                                c.543
 X                                                                  p.180

          .         .         .         .         .         .       g.60869
 gaggtctcggggccctggtcttggaggtgactgctgtctggactgcgaagtctctgtctt       c.*60

          .         .         .         .         .         .       g.60929
 ggcctattctccgcactgtcccatcctggaccggcccagctgacaccacccagtccttcg       c.*120

          .         .         .         .         .         .       g.60989
 ggggcgccggagagatcctgggctggagctgatcgaacctccctactaacctgcccagtg       c.*180

          .         .         .         .         .         .       g.61049
 gtaccttccactgggactctccgcctcctgcaggtggaacgttccaagaaggaccccgcc       c.*240

          .         .         .         .         .         .       g.61109
 ctatcccaccccgcccctgccagcgcatttgttgagcactttggaaagacagcgtctttt       c.*300

          .         .         .         .         .         .       g.61169
 atcagaccccacctccctaccgctaggtaggccagcaggacgtccacctcttttggcaaa       c.*360

          .         .         .         .         .         .       g.61229
 acaaaattctgcacccggatttagccacctctcattctgtcacccgcaccctcactcacc       c.*420

          .         .         .         .         .         .       g.61289
 tgagtggacccttcccctaggacgctcatcctttgcaccgaacaccacctacctcctcct       c.*480

          .         .         .         .         .         .       g.61349
 cattggtacagaccattgtaaagatgcacaaagttcctacggacttcccgacccgccccc       c.*540

          .         .         .         .         .         .       g.61409
 ttccatctacctcagtcttagggggaaaggtgggggtgaatcctggactgcgttagctcc       c.*600

          .         .         .         .         .         .       g.61469
 aatgagtcaccaccctgcggctcctgaccttaatccatcttagtacctgtcattgacatc       c.*660

          .         .         .         .         .         .       g.61529
 ctcccctccctgagtggatcgatccaacataacccccctcttcttccacctatggcgcac       c.*720

          .         .         .         .         .         .       g.61589
 cccactggcatggctatgctgggtcttccagggaaacgcctcccagcccggcattctgtg       c.*780

          .         .         .         .         .         .       g.61649
 gtctgttccagcaggacgtggccttttgggaggaaaaaccggtcttgaccagggctagtc       c.*840

          .         .         .         .         .         .       g.61709
 cattctggctttcaggctcagtcacttggtcaccagtccccagtcctggacctactgcta       c.*900

          .         .         .         .         .         .       g.61769
 ctgtccttttatccggtcctccctcgctgtcctcttcagttgcctttgctagggaccggc       c.*960

          .         .         .         .         .         .       g.61829
 ctgtccctttactacctaagtcatcgtcagttcgcccaacttccctccaaatctgcccct       c.*1020

          .         .         .         .         .         .       g.61889
 cacggtacgcagggatcgcccttccttcctgcctttggactggtccaggtcctcctccgc       c.*1080

          .         .         .         .         .         .       g.61949
 cctccttcacgcaaaggcctcctccagggggactacctgtccctcagcccagaggtcccc       c.*1140

          .         .         .         .         .         .       g.62009
 ctgtccaagcggggtattccaccaggccatatgacctacccacccgacaactgaaggggg       c.*1200

          .         .         .         .         .         .       g.62069
 cgtggatgagctctgtgactctgaatgctactttataaatcgactgtcagcgttttctaa       c.*1260

          .         .                                               g.62098
 ttaaaggagctctggggtaaagatcttaa                                      c.*1289

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.