ORAI calcium release-activated calcium modulator 1 (ORAI1) - coding DNA reference sequence

(used for variant description)

(last modified December 16, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_032790.3 in the ORAI1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007500.1, covering ORAI1 transcript NM_032790.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5013
                                                gccgcccgggggc       c.-181

 .         .         .         .         .         .                g.5073
 ttttgccagcggcgccgcgggcctgcgtgctggggcagcgggcacttcttcgacctcgtc       c.-121

 .         .         .         .         .         .                g.5133
 ctcctcgtcctgtgcggccggccgggtgaggccgggcccgcgtagggggcagtcggcggc       c.-61

 .         .         .         .         .         .                g.5193
 tgcctccggcggaggtgcctcgcggcgcccgggccggcccgcgcctcggcggcgtgctcc       c.-1

          .         .         .         .         .         .       g.5253
 ATGCATCCGGAGCCCGCCCCGCCCCCGAGCCGCAGCAGTCCCGAGCTTCCCCCAAGCGGC       c.60
 M  H  P  E  P  A  P  P  P  S  R  S  S  P  E  L  P  P  S  G         p.20

          .         .         .         .         .         .       g.5313
 GGCAGCACCACCAGCGGCAGCCGCCGGAGCCGCCGCCGCAGCGGGGACGGGGAGCCCCCG       c.120
 G  S  T  T  S  G  S  R  R  S  R  R  R  S  G  D  G  E  P  P         p.40

          .         .         .         .         .         .       g.5373
 GGGGCCCCGCCACCGCCACCGCCGCCGTCCGCCGTCACCTACCCGGACTGGATCGGCCAG       c.180
 G  A  P  P  P  P  P  P  P  S  A  V  T  Y  P  D  W  I  G  Q         p.60

          .         .         .         .         .         .       g.5433
 AGTTACTCCGAGGTGATGAGCCTCAACGAGCACTCCATGCAGGCGCTGTCCTGGCGCAAG       c.240
 S  Y  S  E  V  M  S  L  N  E  H  S  M  Q  A  L  S  W  R  K         p.80

          .         .         .         .         .         .       g.5493
 CTCTACTTGAGCCGCGCCAAGCTTAAAGCCTCCAGCCGGACCTCGGCTCTGCTCTCCGGC       c.300
 L  Y  L  S  R  A  K  L  K  A  S  S  R  T  S  A  L  L  S  G         p.100

           | 02        .         .         .         .         .    g.19543
 TTCGCCATG | GTGGCAATGGTGGAGGTGCAGCTGGACGCTGACCACGACTACCCACCGGGG    c.360
 F  A  M   | V  A  M  V  E  V  Q  L  D  A  D  H  D  Y  P  P  G      p.120

          .         .         .         .         .         .       g.19603
 CTGCTCATCGCCTTCAGTGCCTGCACCACAGTGCTGGTGGCTGTGCACCTGTTTGCGCTC       c.420
 L  L  I  A  F  S  A  C  T  T  V  L  V  A  V  H  L  F  A  L         p.140

          .         .         .         .         .         .       g.19663
 ATGATCAGCACCTGCATCCTGCCCAACATCGAGGCGGTGAGCAACGTGCACAATCTCAAC       c.480
 M  I  S  T  C  I  L  P  N  I  E  A  V  S  N  V  H  N  L  N         p.160

          .         .         .         .         .         .       g.19723
 TCGGTCAAGGAGTCCCCCCATGAGCGCATGCACCGCCACATCGAGCTGGCCTGGGCCTTC       c.540
 S  V  K  E  S  P  H  E  R  M  H  R  H  I  E  L  A  W  A  F         p.180

          .         .         .         .         .         .       g.19783
 TCCACCGTCATCGGCACGCTGCTCTTCCTAGCTGAGGTGGTGCTGCTCTGCTGGGTCAAG       c.600
 S  T  V  I  G  T  L  L  F  L  A  E  V  V  L  L  C  W  V  K         p.200

          .         .         .         .         .         .       g.19843
 TTCTTGCCCCTCAAGAAGCAGCCAGGCCAGCCAAGGCCCACCAGCAAGCCCCCCGCCAGT       c.660
 F  L  P  L  K  K  Q  P  G  Q  P  R  P  T  S  K  P  P  A  S         p.220

          .         .         .         .         .         .       g.19903
 GGCGCAGCAGCCAACGTCAGCACCAGCGGCATCACCCCGGGCCAGGCAGCTGCCATCGCC       c.720
 G  A  A  A  N  V  S  T  S  G  I  T  P  G  Q  A  A  A  I  A         p.240

          .         .         .         .         .         .       g.19963
 TCGACCACCATCATGGTGCCCTTCGGCCTGATCTTTATCGTCTTCGCCGTCCACTTCTAC       c.780
 S  T  T  I  M  V  P  F  G  L  I  F  I  V  F  A  V  H  F  Y         p.260

          .         .         .         .         .         .       g.20023
 CGCTCACTGGTTAGCCATAAGACTGACCGACAGTTCCAGGAGCTCAACGAGCTGGCGGAG       c.840
 R  S  L  V  S  H  K  T  D  R  Q  F  Q  E  L  N  E  L  A  E         p.280

          .         .         .         .         .         .       g.20083
 TTTGCCCGCTTACAGGACCAGCTGGACCACAGAGGGGACCACCCCCTGACGCCCGGCAGC       c.900
 F  A  R  L  Q  D  Q  L  D  H  R  G  D  H  P  L  T  P  G  S         p.300

          .                                                         g.20095
 CACTATGCCTAG                                                       c.912
 H  Y  A  X                                                         p.303

          .         .         .         .         .         .       g.20155
 gcccatgtggtctgggcccttccagtgctttggccttacgcccttccccttgaccttgtc       c.*60

          .         .         .         .         .         .       g.20215
 ctgccccagcctcacggacagcctgcgcagggggctgggcttcagcaaggggcagagcat       c.*120

          .         .         .         .         .         .       g.20275
 ggagggaagaggatttttataagagaaatttctgcactttgaaactgtcctctaagagaa       c.*180

          .         .         .         .         .         .       g.20335
 taagcatttcctgttcttccagctccaggtccacctcctgttgggaggcggtggggggcc       c.*240

          .         .         .         .         .         .       g.20395
 aaagtggggccacacactcgctgtgtcccctctcctcccctgtgccagtgccacctgggt       c.*300

          .         .         .         .         .         .       g.20455
 gcctcctcctgtcctgtccgtctcaacctccctcccgtccagcattgagtgtgtacatgt       c.*360

          .         .         .                                     g.20492
 gtgtgtgacacataaatatactcataaggacacctcc                              c.*397

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ORAI calcium release-activated calcium modulator 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center