(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.82973
gtgagaccccaggcactgtgctgtcccccagggcctccagctcagcccccttctccctga c.1803+60
. . . . . . g.83033
gtcacctgggtcccaggctttgcctgttgctgccctgtctacctgaggagtcatacctca c.1803+120
. . . . . . g.83093
ggataaggcttctccccaggaagcagaggcccccactcagccccgcaacaggactctgcc c.1803+180
. . . . . g.83150
ctcgtccactgcctgcctgtgctctgtctcacaacggccgccaggtctcacgatggt c.1803+237
--------------------- middle of intron ---------------------
. . . . . g.83207
gcctcccctctgcccctcttcccagccacggctgtccctgtggtgtctgcagccagc c.1804-181
. . . . . . g.83267
cctgcttccatggatatccaggctggggggccgttggggtgtgggctgcctggccccaaa c.1804-121
. . . . . . g.83327
gccgggtgggatgcccccaccatccacccccacggcctgtctgtgagacggaaggaggcc c.1804-61
. . . . . . g.83387
tggcccccgacctgccacccttactcaagctcaggaacgctttgaactgcctccccacag c.1804-1
Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center