(intronic numbering for coding DNA Reference Sequence)
. . . . g.84270
gtgggcccagcctcccatcctcctgtggcctggccctcccacct c.2093+44
--------------------- middle of intron ---------------------
g.84271 . . . . g.84314
c.2094-44 ccctgggcccccaagacctcacctcccgcctctgcccaccccag c.2094-1
Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center