parkinson protein 7 (PARK7) - coding DNA reference sequence

(used for variant description)

(last modified October 2, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_007262.4 in the PARK7 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008271.1, covering PARK7 transcript NM_007262.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5043
                  tgagtctgcgcagtgtggggctgagggaggccggacggcgcgc       c.-121

 .         .         .         .         .         .                g.5103
 gtgcgtgctggcgtgcgttcattttcagcctggtgtggggtgagtggtacccaacgggcc       c.-61

 .         .         .         .       | 02 .         .             g.6132
 ggggcgccgcgtccgcaggaagaggcgcggggtgcag | gcttgtaaacatataacataaaa    c.-1

          .         .         .         .         .         .       g.6192
 ATGGCTTCCAAAAGAGCTCTGGTCATCCTGGCTAAAGGAGCAGAGGAAATGGAGACGGTC       c.60
 M  A  S  K  R  A  L  V  I  L  A  K  G  A  E  E  M  E  T  V         p.20

          .         .         . | 03       .         .         .    g.8700
 ATCCCTGTAGATGTCATGAGGCGAGCTGGG | ATTAAGGTCACCGTTGCAGGCCTGGCTGGA    c.120
 I  P  V  D  V  M  R  R  A  G   | I  K  V  T  V  A  G  L  A  G      p.40

          .         .         .         .         .         .       g.8760
 AAAGACCCAGTACAGTGTAGCCGTGATGTGGTCATTTGTCCTGATGCCAGCCTTGAAGAT       c.180
 K  D  P  V  Q  C  S  R  D  V  V  I  C  P  D  A  S  L  E  D         p.60

          .   | 04     .         .         .         .         .    g.12739
 GCAAAAAAAGAG | GGACCATATGATGTGGTGGTTCTACCAGGAGGTAATCTGGGCGCACAG    c.240
 A  K  K  E   | G  P  Y  D  V  V  V  L  P  G  G  N  L  G  A  Q      p.80

          .   | 05     .         .         .         .         .    g.14288
 AATTTATCTGAG | TCTGCTGCTGTGAAGGAGATACTGAAGGAGCAGGAAAACCGGAAGGGC    c.300
 N  L  S  E   | S  A  A  V  K  E  I  L  K  E  Q  E  N  R  K  G      p.100

          .         .   | 06     .         .         .         .    g.21036
 CTGATAGCCGCCATCTGTGCAG | GTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGA    c.360
 L  I  A  A  I  C  A  G |   P  T  A  L  L  A  H  E  I  G  F  G      p.120

          .         .         .         .          | 07        .    g.28251
 AGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAG | GTCATTACACC    c.420
 S  K  V  T  T  H  P  L  A  K  D  K  M  M  N  G  G |   H  Y  T      p.140

          .         .         .         .         .         .       g.28311
 TACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACC       c.480
 Y  S  E  N  R  V  E  K  D  G  L  I  L  T  S  R  G  P  G  T         p.160

          .         .         .         .         .         .       g.28371
 AGCTTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAA       c.540
 S  F  E  F  A  L  A  I  V  E  A  L  N  G  K  E  V  A  A  Q         p.180

          .         .         .                                     g.28401
 GTGAAGGCTCCACTTGTTCTTAAAGACTAG                                     c.570
 V  K  A  P  L  V  L  K  D  X                                       p.189

          .         .         .         .         .         .       g.28461
 agcagcgaactgcgacgatcacttagagaaacaggccgttaggaatccattctcactgtg       c.*60

          .         .         .         .         .         .       g.28521
 ttcgctctaaacaaaacagtggtaggttaatgtgttcagaagtcgctgtccttactactt       c.*120

          .         .         .         .         .         .       g.28581
 ttgcggaagtatggaagtcacaactacacagagatttctcagcctacaaattgtgtctat       c.*180

          .         .         .         .                           g.28629
 acatttctaagccttgtttgcagaataaacagggcatttagcaaacta                   c.*228

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Parkinson protein 7 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.