phosphodiesterase 6D, cGMP-specific, rod, delta (PDE6D) - coding DNA reference sequence

(used for variant description)

(last modified March 8, 2013)

This file was created to facilitate the description of sequence variants on transcript NM_002601.2 in the PDE6D gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering PDE6D transcript NM_002601.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5030
                               ggggagagagaggccggtcctggtctggcc       c.-121

 .         .         .         .         .         .                g.5090
 gctgcggctgctagcccgaggtctccaagccgggctgcggctccatcctcggctcctggg       c.-61

 .         .         .         .         .         .                g.5150
 caccgtctgcgaggctccgccgaccagagtgagaaagccgcgggcggcgaccgccgcatc       c.-1

          .         .         .         .         . | 02       .    g.47086
 ATGTCAGCCAAGGACGAGCGGGCCAGGGAGATCCTGAGGGGCTTCAAACT | AAATTGGATG    c.60
 M  S  A  K  D  E  R  A  R  E  I  L  R  G  F  K  L  |  N  W  M      p.20

          .         .         .         .         .         .       g.47146
 AACCTTCGGGATGCTGAGACAGGGAAGATACTCTGGCAAGGAACAGAAGACCTGTCTGTC       c.120
 N  L  R  D  A  E  T  G  K  I  L  W  Q  G  T  E  D  L  S  V         p.40

          .          | 03        .         .         .         .    g.48167
 CCTGGTGTGGAGCATGAAG | CCCGTGTTCCCAAGAAAATCCTCAAGTGCAAGGCAGTGTCT    c.180
 P  G  V  E  H  E  A |   R  V  P  K  K  I  L  K  C  K  A  V  S      p.60

          .         .         .         .         .         .       g.48227
 CGAGAACTTAATTTTTCTTCGACAGAACAAATGGAAAAATTCCGCCTGGAACAAAAAGTT       c.240
 R  E  L  N  F  S  S  T  E  Q  M  E  K  F  R  L  E  Q  K  V         p.80

          .         .      | 04  .         .         .         .    g.49007
 TACTTCAAAGGGCAATGCCTAGAAG | AATGGTTCTTCGAGTTTGGCTTTGTGATCCCTAAC    c.300
 Y  F  K  G  Q  C  L  E  E |   W  F  F  E  F  G  F  V  I  P  N      p.100

          .         .         .         .         .         .       g.49067
 TCCACAAATACCTGGCAGTCCTTGATAGAGGCAGCACCCGAGTCCCAGATGATGCCAGCA       c.360
 S  T  N  T  W  Q  S  L  I  E  A  A  P  E  S  Q  M  M  P  A         p.120

          .  | 05      .         .         .         .         .    g.53280
 AGCGTCTTAAC | TGGGAACGTTATCATAGAAACAAAGTTTTTTGACGACGATCTTCTTGTA    c.420
 S  V  L  T  |  G  N  V  I  I  E  T  K  F  F  D  D  D  L  L  V      p.140

          .         .         .                                     g.53313
 AGCACATCCAGAGTGAGACTTTTCTATGTTTGA                                  c.453
 S  T  S  R  V  R  L  F  Y  V  X                                    p.150

          .         .         .         .         .         .       g.53373
 aagaagaatgtgtgtacatttcaagaatttgggttttttggagggaggaggaaactgttt       c.*60

          .         .         .         .         .         .       g.53433
 acttttttcctccacacgtttgatttttgacacatacacccctaattccctcaacagcag       c.*120

          .         .         .         .         .         .       g.53493
 aacctacctgcagccaccaggggaccagctctgtgtaggtaaccagatggctctttttcc       c.*180

          .         .         .         .         .         .       g.53553
 caagccaccatcttccagctgaccagactaaactcccaaccccagaccagggcaggggac       c.*240

          .         .         .         .         .         .       g.53613
 aggtctcaagtccttcccagcatacacacagggaacaaacacataccacaaaccggtaac       c.*300

          .         .         .         .         .         .       g.53673
 tgtacctgtcaccctccttgtctcctccttgggccctacaggctacacatctacctttgg       c.*360

          .         .         .         .         .         .       g.53733
 cccctggttttggaaaaattccgtgttcctgacccatgtttagttttttcctaccatttc       c.*420

          .         .         .         .         .         .       g.53793
 tatttcatacattctcatacatttaacttgtaaaatagactgtgatattattacataatg       c.*480

          .         .         .                                     g.53828
 taattaaaaatatgaattaaaatattcctacagtc                                c.*515

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Phosphodiesterase 6D, cGMP-specific, rod, delta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.