phosphodiesterase 6G, cGMP-specific, rod, gamma (PDE6G) - coding DNA reference sequence

(used for variant description)

(last modified August 30, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_002602.3 in the PDE6G gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009834.2, covering PDE6G transcript NM_002602.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5024
                                     cagcgagataaaggccggggctgg       c.-121

 .         .         .         .         .         .                g.5084
 caccctgcggagggaggcccagcactcacagcacagccccctgagacccgccctgcactt       c.-61

 . | 02       .         .         .         .         .             g.8272
 g | accgcagcaggagggagtccaggagccaaggttgccgcggtgtctccgtcagcctcacc    c.-1

          .         .         .         .         .         .       g.8332
 ATGAACCTGGAACCGCCCAAGGCTGAGTTCCGGTCAGCCACCAGGGTGGCCGGGGGACCT       c.60
 M  N  L  E  P  P  K  A  E  F  R  S  A  T  R  V  A  G  G  P         p.20

          .         .         .         .         .         .       g.8392
 GTCACCCCCAGGAAAGGGCCCCCTAAATTTAAGCAGCGACAGACCAGGCAGTTCAAGAGC       c.120
 V  T  P  R  K  G  P  P  K  F  K  Q  R  Q  T  R  Q  F  K  S         p.40

          .         .       | 03 .         .         .         .    g.9926
 AAGCCCCCAAAGAAAGGCGTTCAAGG | GTTTGGGGACGACATCCCTGGAATGGAAGGCCTG    c.180
 K  P  P  K  K  G  V  Q  G  |  F  G  D  D  I  P  G  M  E  G  L      p.60

         | 04.         .         .         .         .         .    g.10480
 GGAACAG | ACATCACAGTCATCTGCCCTTGGGAGGCCTTCAACCACCTGGAGCTGCACGAG    c.240
 G  T  D |   I  T  V  I  C  P  W  E  A  F  N  H  L  E  L  H  E      p.80

          .         .                                               g.10504
 CTGGCCCAATATGGCATCATCTAG                                           c.264
 L  A  Q  Y  G  I  I  X                                             p.87

          .         .         .         .         .         .       g.10564
 cacgaggccctgctgaagtccagaccctccccctcctgcccactgtgctctaaaccctgc       c.*60

          .         .         .         .         .         .       g.10624
 tcaggattcctgttgaggagatgcctccctagcccagatggcacctggacaccaggatgg       c.*120

          .         .         .         .         .         .       g.10684
 gactgcaacctcaggtctccccctacatattaataccagtcaccaggagcccaccacctc       c.*180

          .         .         .         .         .         .       g.10744
 cctctaggatgccccctcaggggctggccaggccctgctcaacatctggagatacaggcc       c.*240

          .         .         .         .         .         .       g.10804
 cacccctcagtcctgcccacagagaggcttggtcggtctccactcccagggagaacggga       c.*300

          .         .         .         .         .         .       g.10864
 agtggaccccagcccgggagcctgctggaccccagatcgtcccctcctcccagctggaaa       c.*360

          .         .         .         .         .         .       g.10924
 gctagggcaggtctccccagagtgcttctgcaccccagccccctgtcctgcctgtaaggg       c.*420

          .         .         .         .         .         .       g.10984
 gatacagagaagctccccgtctctgcatcccttcccaggggggtgcccttagtttggaca       c.*480

          .         .         .         .         .         .       g.11044
 tgctgggtagcaggactccagggcgtgcacggtgagcagatgaggccccaagctcatcac       c.*540

          .         .         .         .         .         .       g.11104
 accagggggccatccttctcaatacagcctgcccttgcagtccctatttcaaaataaaat       c.*600

          .                                                         g.11119
 tagtgtgtccttgcc                                                    c.*615

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Phosphodiesterase 6G, cGMP-specific, rod, gamma protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.