phosphodiesterase 6H, cGMP-specific, cone, gamma (PDE6H) - coding DNA reference sequence

(used for variant description)

(last modified November 25, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_006205.2 in the PDE6H gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016859.1, covering PDE6H transcript NM_006205.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5046
               caaagatccttttgtcttttgcaaagaaggcagctgggcagctgat       c.-61

 .         .         | 02         .         .         .             g.9991
 aggaacaacattcagctcc | gaggctgaaagggaaacatcagccgcccggggggagttaaa    c.-1

          .         .         .         .         .         .       g.10051
 ATGAGTGACAACACTACTCTGCCTGCTCCAGCTTCAAACCAGGGTCCTACCACCCCACGC       c.60
 M  S  D  N  T  T  L  P  A  P  A  S  N  Q  G  P  T  T  P  R         p.20

          .         .         .         .         .         .       g.10111
 AAAGGCCCTCCCAAGTTCAAGCAGAGGCAGACTCGCCAATTCAAGAGTAAACCTCCAAAG       c.120
 K  G  P  P  K  F  K  Q  R  Q  T  R  Q  F  K  S  K  P  P  K         p.40

          .     | 03   .         .         .         .      | 04  . g.13383
 AAAGGTGTGAAAGG | ATTTGGAGATGACATTCCAGGAATGGAGGGGCTAGGAACAG | ATATC c.180
 K  G  V  K  G  |  F  G  D  D  I  P  G  M  E  G  L  G  T  D |   I   p.60

          .         .         .         .         .         .       g.13443
 ACAGTGATTTGTCCATGGGAGGCATTCAGCCACCTGGAATTGCATGAGCTCGCTCAGTTT       c.240
 T  V  I  C  P  W  E  A  F  S  H  L  E  L  H  E  L  A  Q  F         p.80

          .                                                         g.13455
 GGGATTATCTGA                                                       c.252
 G  I  I  X                                                         p.83

          .         .         .         .         .         .       g.13515
 agtgccagaggttctgccactctcaatgacatctgctgtaattttggttgcttttgccct       c.*60

          .         .         .         .         .         .       g.13575
 gttgatctgccggagtcttgaaattcagctgattggaagtggtttctttgactttcaagg       c.*120

          .         .         .         .         .         .       g.13635
 tcattccctatcagttactactaagagttctcttactgtcagaatctctcttgcagtaca       c.*180

          .         .         .         .         .         .       g.13695
 gctcaaaatagtggatgcatttcaaacttgaccaccttttcctaccagctagttagaagt       c.*240

          .         .         .         .         .         .       g.13755
 catcaatatttctctacattttgtttatctgtaagtcctttaaatctatttttgctaggc       c.*300

          .         .         .         .         .         .       g.13815
 attcattatgattaatagtagacttttaagacaacatttatgtcactccccacctcctca       c.*360

          .         .                                               g.13844
 tatttaataaaggagatatttaccttgaa                                      c.*389

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Phosphodiesterase 6H, cGMP-specific, cone, gamma protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.