prodynorphin (PDYN) - coding DNA reference sequence

(used for variant description)

(last modified June 11, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_024411.4 in the PDYN gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_028027.1, covering PDYN transcript NM_024411.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.4994
                           agaatccgccccctccccaacacggctgccttcc       c.-421

 .         .         .         .         .         .                g.5054
 tcctccacatccctgtcacgaagagaagcctattgtgtcaggcccagggagttcgagttg       c.-361

 .         .         .         .         .         .                g.5114
 aagggcctgggggtctgtgctctgactgctctcagccacttccccattggctcccagcag       c.-301

 .         .         .         .         .         .                g.5174
 cctgtgctcagcaagggctgagcgacaggggaggctctcgtccataaaaggggggaagag       c.-241

 .         .         .         .         .         .                g.5234
 gcaccagaactgccatttgaaggggctttggtggtgttcacagctgcctctttggcacct       c.-181

 .         .         .         .         .         .                g.5294
 cctcccaagccggagtcaaggaggcccctgagccttggaccagccactgccacctccgac       c.-121

 .         .         .         .         . | 02       .             g.6621
 ctgctcggccagaagctgcccagggacaaagcagagtgcag | gtcatttatcttcaggctt    c.-61

 .         .         .         .         . | 03       .             g.16161
 tgagatctgcgtggggggagctgttgcagcagcccaagccg | caggaattgctgagacagg    c.-1

          .         .         .         .         .         .       g.16221
 ATGGCCTGGCAGGGGCTGGTCCTGGCTGCCTGCCTCCTCATGTTCCCCTCCACCACAGCG       c.60
 M  A  W  Q  G  L  V  L  A  A  C  L  L  M  F  P  S  T  T  A         p.20

          .         .         .         .         .         .       g.16281
 GACTGCCTGTCGCGGTGCTCCTTGTGTGCTGTAAAGACCCAGGATGGTCCCAAACCTATC       c.120
 D  C  L  S  R  C  S  L  C  A  V  K  T  Q  D  G  P  K  P  I         p.40

           | 04        .         .         .         .         .    g.18338
 AATCCCCTG | ATTTGCTCCCTGCAATGCCAGGCTGCCCTGCTGCCCTCTGAGGAATGGGAG    c.180
 N  P  L   | I  C  S  L  Q  C  Q  A  A  L  L  P  S  E  E  W  E      p.60

          .         .         .         .         .         .       g.18398
 AGATGCCAGAGCTTTCTGTCTTTTTTCACCCCCTCCACCCTTGGGCTCAATGACAAGGAG       c.240
 R  C  Q  S  F  L  S  F  F  T  P  S  T  L  G  L  N  D  K  E         p.80

          .         .         .         .         .         .       g.18458
 GACTTGGGGAGCAAGTCGGTTGGGGAAGGGCCCTACAGTGAGCTGGCCAAGCTCTCTGGG       c.300
 D  L  G  S  K  S  V  G  E  G  P  Y  S  E  L  A  K  L  S  G         p.100

          .         .         .         .         .         .       g.18518
 TCATTCCTGAAGGAGCTGGAGAAAAGCAAGTTTCTCCCAAGTATCTCAACAAAGGAGAAC       c.360
 S  F  L  K  E  L  E  K  S  K  F  L  P  S  I  S  T  K  E  N         p.120

          .         .         .         .         .         .       g.18578
 ACTCTGAGCAAGAGCCTGGAGGAGAAGCTCAGGGGTCTCTCTGACGGGTTTAGGGAGGGA       c.420
 T  L  S  K  S  L  E  E  K  L  R  G  L  S  D  G  F  R  E  G         p.140

          .         .         .         .         .         .       g.18638
 GCAGAGTCTGAGCTGATGAGGGATGCCCAGCTGAACGATGGTGCCATGGAGACTGGCACA       c.480
 A  E  S  E  L  M  R  D  A  Q  L  N  D  G  A  M  E  T  G  T         p.160

          .         .         .         .         .         .       g.18698
 CTCTATCTCGCTGAGGAGGACCCCAAGGAGCAGGTCAAACGCTATGGGGGCTTTTTGCGC       c.540
 L  Y  L  A  E  E  D  P  K  E  Q  V  K  R  Y  G  G  F  L  R         p.180

          .         .         .         .         .         .       g.18758
 AAATACCCCAAGAGGAGCTCAGAGGTGGCTGGGGAGGGGGACGGGGATAGCATGGGCCAT       c.600
 K  Y  P  K  R  S  S  E  V  A  G  E  G  D  G  D  S  M  G  H         p.200

          .         .         .         .         .         .       g.18818
 GAGGACCTGTACAAACGCTATGGGGGCTTCTTGCGGCGCATTCGTCCCAAGCTCAAGTGG       c.660
 E  D  L  Y  K  R  Y  G  G  F  L  R  R  I  R  P  K  L  K  W         p.220

          .         .         .         .         .         .       g.18878
 GACAACCAGAAGCGCTATGGCGGTTTTCTCCGGCGCCAGTTCAAGGTGGTGACTCGGTCT       c.720
 D  N  Q  K  R  Y  G  G  F  L  R  R  Q  F  K  V  V  T  R  S         p.240

          .         .         .         .                           g.18923
 CAGGAAGATCCGAATGCTTACTCTGGAGAGCTTTTTGATGCATAA                      c.765
 Q  E  D  P  N  A  Y  S  G  E  L  F  D  A  X                        p.254

          .         .         .         .         .         .       g.18983
 gcacctcttttcatggagtagagtcaggagaaacccctgacaccttttcaggttggagtg       c.*60

          .         .         .         .         .         .       g.19043
 cattcattcatcctcttatatgtgccccttccccatgctcagctcagcattgtgtacaaa       c.*120

          .         .         .         .         .         .       g.19103
 atatccaagcccagcctatctctcttctgcgtgggagtatgttatttctctggggtctgt       c.*180

          .         .         .         .         .         .       g.19163
 gatggggaagggtggatgtcccttccccacaataggcttagtgcttggctcagacaccta       c.*240

          .         .         .         .         .         .       g.19223
 gactctaaaactatcagcagcggcagcagcagcagcagcagcagtttgtgatctgtcctt       c.*300

          .         .         .         .         .         .       g.19283
 ccaacctgttcacgtgactcctcaattccagggaaccagagcgatgtgttctttgtacct       c.*360

          .         .         .         .         .         .       g.19343
 gtaggtctatgatgtccaaacttaacagatcacatgcccctcttagaagaaatatgagca       c.*420

          .         .         .         .         .         .       g.19403
 tgctccctcatgcagatagtatacacatcataaacaaagagtagaactttaaaagaaggt       c.*480

          .         .         .         .         .         .       g.19463
 aaataatcatacacagaaatcctaacattatattcccaaatctcaaaagatctcctgtgc       c.*540

          .         .         .         .         .         .       g.19523
 acctgactttggagacgatgctttaggtaaaaagcttaaacattgccttatattggatca       c.*600

          .         .         .         .         .         .       g.19583
 ggaacccttacagtagagggtccagtcttctagtgggtttaatgtttagtcagtgtactc       c.*660

          .         .         .         .         .         .       g.19643
 tgagtcctcattgttcagaaaagcacctcttgaagaactgacttcctgaactcccagtca       c.*720

          .         .         .         .         .         .       g.19703
 tgttggtaccctggacagtgcctaactccttacagaagggagtgaaaacctctttcggaa       c.*780

          .         .         .         .         .         .       g.19763
 atgattgagagcagcctcttgaatgcttaaatgatcaaggagggagaaaggcaaaccaat       c.*840

          .         .         .         .         .         .       g.19823
 ttgttctgtgcaacaaactcaaaatgtggaccagttccctcagccctcattaaactaatt       c.*900

          .         .         .         .         .         .       g.19883
 aaactgatgggtatcatgcttctactccatggtgaactgaagcagagtcaagctgatgaa       c.*960

          .         .         .         .         .         .       g.19943
 gttaagcacaaccatgttcttgagcagctgaattggctgccaagagtccaagccatctgg       c.*1020

          .         .         .         .         .         .       g.20003
 cccaacatacgcactgggcattgggtaagggactccagaagcagcagctagaaagagaaa       c.*1080

          .         .         .         .         .         .       g.20063
 aagccctcttcaatccccataatgcttctttcctcttaatgtctcaaaataaaaccagaa       c.*1140

          .         .         .         .         .         .       g.20123
 agaggaataaaatgattaagtgcttgaggccaaatgagttcccttgattcaaataaccct       c.*1200

          .         .         .         .         .         .       g.20183
 gaatcagaggcagagacctcctgatgtcttggtttccatcaaagccctccctgtctgtct       c.*1260

          .         .         .         .         .         .       g.20243
 gtctctcttttgctctctcattcccaggcactctcttttggtttgtgggtccaggagatg       c.*1320

          .         .         .         .         .         .       g.20303
 aggctggataggagaggaaaaggcttgagtctggataatttgtataagatgctgctgagc       c.*1380

          .         .         .         .         .         .       g.20363
 acatctcttcatgcgcagtccccaggtatctgatgatgttctgaaatggatagattgttt       c.*1440

          .         .         .         .         .         .       g.20423
 tagagttattttgtgtcctttaaaaaaatcccatttatgcaatttacttggaatttgctt       c.*1500

          .         .         .         .         .         .       g.20483
 agcctttaataggcttgtgtaatttcctgctcctccagtacaataaataaaagaaagatg       c.*1560

                                                                    g.20490
 ctgatga                                                            c.*1567

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Prodynorphin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.