(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.24051
gtgggaggaggttgcagagagggcttgggggcaggaaggggatccctggtaccaccccca c.1841+60
. g.24066
acctcccgagggctg c.1841+75
--------------------- middle of intron ---------------------
g.24067 . g.24081
c.1842-75 aagggcatcctggca c.1842-61
. . . . . . g.24141
cctccggaactgaaatcctgcctgcccctcccacccctgctgtctctcgccctctcccag c.1842-1
Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center