PET100 homolog (S. cerevisiae) (PET100) - coding DNA reference sequence

(used for variant description)

(last modified September 29, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_001171155.1 in the PET100 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_034117.1, covering PET100 transcript NM_001171155.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5049
            ggagggtcggctttgggcggaactggctttgttgaccgggagaaacgag       c.-1

          .         .        | 02.         .         .         .    g.5821
 ATGGGGGTGAAGCTGGAGATATTTCGG | ATGATAATCTACCTCACTTTCCCTGTGGCTATG    c.60
 M  G  V  K  L  E  I  F  R   | M  I  I  Y  L  T  F  P  V  A  M      p.20

          .         .         .         .         .     | 03   .    g.6044
 TTCTGGGTTTCCAATCAGGCCGAGTGGTTTGAGGACGATGTCATACAGCGCAAG | AGGGAG    c.120
 F  W  V  S  N  Q  A  E  W  F  E  D  D  V  I  Q  R  K   | R  E      p.40

          .         | 04         .         .         .         .    g.6730
 CTGTGGCCACCTGAGAAG | CTTCAAGAGATAGAGGAATTCAAAGAGAGGTTACGGAAGCGG    c.180
 L  W  P  P  E  K   | L  Q  E  I  E  E  F  K  E  R  L  R  K  R      p.60

          .         .         .         .                           g.6772
 CGGGAGGAGAAGCTCCTTCGCGACGCCCAGCAGAACTCCTGA                         c.222
 R  E  E  K  L  L  R  D  A  Q  Q  N  S  X                           p.73

          .         .         .         .         .         .       g.6832
 ggcctccaagtgggagtcctagcccctcccctgatgaaatatacatatactcagttcctt       c.*60

                                                                    g.6840
 gttattca                                                           c.*68

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The PET100 homolog (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.