PET117 homolog (S. cerevisiae) (PET117) - coding DNA reference sequence

(used for variant description)

(last modified June 25, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_001164811.1 in the PET117 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000020.10, covering PET117 transcript NM_001164811.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5041
                    gaggggtcgagcctgggcagtacaggcggcggtgcgcactc       c.-61

 .         .         .         .         .         .                g.5101
 tgcggcggcctctgcgcctcgggcgggcgggagagagaggccgcggccgccagcgtgggg       c.-1

          .         .         .         .         .         .       g.5161
 ATGTCTAGGAGCTCGAAGGTGGTGCTGGGCCTCTCGGTGCTGCTGACGGCGGCCACAGTG       c.60
 M  S  R  S  S  K  V  V  L  G  L  S  V  L  L  T  A  A  T  V         p.20

          .         .         .       | 02 .         .         .    g.9377
 GCCGGCGTACATGTGAAGCAGCAGTGGGACCAGCAG | AGGCTTCGTGACGGAGTTATCAGA    c.120
 A  G  V  H  V  K  Q  Q  W  D  Q  Q   | R  L  R  D  G  V  I  R      p.40

          .         .         .         .         .         .       g.9437
 GACATTGAGAGGCAAATTCGGAAAAAAGAAAACATTCGTCTTTTGGGAGAACAGATTATT       c.180
 D  I  E  R  Q  I  R  K  K  E  N  I  R  L  L  G  E  Q  I  I         p.60

          .         .         .         .         .         .       g.9497
 TTGACTGAGCAACTTGAAGCAGAAAGAGAGAAGATGTTATTGGCAAAAGGATCTCAAAAA       c.240
 L  T  E  Q  L  E  A  E  R  E  K  M  L  L  A  K  G  S  Q  K         p.80

                                                                    g.9503
 TCATGA                                                             c.246
 S  X                                                               p.81

          .         .         .         .         .         .       g.9563
 cttgaatgtgaaatatctgttggacagacaacacgagtttgtgtgtgtgtgttgatggag       c.*60

          .         .         .         .         .         .       g.9623
 agtagcttagtagtatcttcatctttttttttggtcactgtccttttaaacttgatcaaa       c.*120

          .         .         .         .         .         .       g.9683
 taaaggacagtgggtcatataagttactgctttcagggtcccttatatctgaataaagga       c.*180

          .         .         .         .         .         .       g.9743
 gtgtgggcagacactttttggaagagtctgtctgggtgatcctggtagaagccccattag       c.*240

          .         .         .         .         .         .       g.9803
 ggtcactgtccagtgcttagggttgttactgagaagcactgccgagcttgtgagaaggaa       c.*300

          .         .         .         .         .         .       g.9863
 gggatggatagtagcatccacctgagtagtctgatcagtcggcatgatgacgaagccacg       c.*360

          .         .         .         .         .         .       g.9923
 agaacatcgacctcagaaggactggaggaaggtgaagtggagggagagacgctcctgatc       c.*420

          .         .         .         .         .         .       g.9983
 gtcgaatccgaggatcaggcatcagtggacttatcgcacgaccagagtggggattccctc       c.*480

          .         .         .         .         .         .       g.10043
 aacagtgatgaaggagacgtgtcttggatggaggagcagctgtcctacttctgtgacaag       c.*540

          .         .         .         .         .         .       g.10103
 tgccaaaaatggataccagccagtaaggagcttctcaattcctttgatttgtcaattcct       c.*600

          .         .         .         .         .         .       g.10163
 gtgtgaaggtttgtttttccaacctgtgaaagaaacgtgaatgtaaaagagacctaaata       c.*660

          .         .         .         .         .         .       g.10223
 aaaggataattatatttattctctagttgatcagctataaatttatataaaacataggca       c.*720

          .         .         .         .         .         .       g.10283
 tgtttgtactaatgaaacgtactgtcaacctctatcacattgttaaattaacacttttgg       c.*780

          .         .         .                                     g.10315
 tggtaactcaataaaattgagaaaattggaaa                                   c.*812

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The PET117 homolog (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.