peroxisomal biogenesis factor 11 beta (PEX11B) - coding DNA reference sequence

(used for variant description)

(last modified January 16, 2022)


This file was created to facilitate the description of sequence variants on transcript NM_003846.2 in the PEX11B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering PEX11B transcript NM_003846.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5056
     gctagggagtaggggtcgtctgataaggggaagctgtgacgcagacacgcacagta       c.-181

 .         .         .         .         .         .                g.5116
 atacacagatggaggctcaaaagacacgagtttcgcgtcctgaaattccgcttccagggc       c.-121

 .         .         .         .         .         .                g.5176
 caagctttcttttctgatactgtttgtccctcgcgaggcaccgttgggtcgcgcagtagg       c.-61

 .         .         .         .         .         .                g.5236
 cgtgactaggggcgggaagtggggcgggagcagggccgcggagcctgggctgcggctgtc       c.-1

          .         .         .         .         .       | 02 .    g.6112
 ATGGACGCCTGGGTCCGCTTCAGTGCTCAGAGCCAAGCCCGGGAGCGGCTGTGTAG | GGCC    c.60
 M  D  A  W  V  R  F  S  A  Q  S  Q  A  R  E  R  L  C  R  |  A      p.20

          .         .         .         .         .         .       g.6172
 GCCCAGTATGCTTGCTCTCTTCTTGGCCATGCGCTGCAGAGGCATGGAGCCAGTCCTGAG       c.120
 A  Q  Y  A  C  S  L  L  G  H  A  L  Q  R  H  G  A  S  P  E         p.40

          .         .         .         .         .   | 03     .    g.6914
 TTACAGAAACAGATTCGACAACTGGAGAGCCACCTGAGCCTTGGAAGAAAGC | TTCTACGC    c.180
 L  Q  K  Q  I  R  Q  L  E  S  H  L  S  L  G  R  K  L |   L  R      p.60

          .         .         .         .         .         .       g.6974
 CTGGGTAACTCAGCAGATGCCCTTGAGTCAGCCAAAAGAGCTGTTCACCTATCAGATGTT       c.240
 L  G  N  S  A  D  A  L  E  S  A  K  R  A  V  H  L  S  D  V         p.80

          .         .         .         .         .         .       g.7034
 GTCCTGAGATTCTGCATCACTGTTAGTCACCTCAATCGAGCCTTGTACTTCGCCTGTGAC       c.300
 V  L  R  F  C  I  T  V  S  H  L  N  R  A  L  Y  F  A  C  D         p.100

          .         .         .         .         .         .       g.7094
 AATGTCCTGTGGGCTGGAAAGTCTGGACTGGCTCCCCGTGTGGATCAGGAGAAGTGGGCC       c.360
 N  V  L  W  A  G  K  S  G  L  A  P  R  V  D  Q  E  K  W  A         p.120

          .     | 04   .         .         .         .         .    g.11395
 CAGCGTTCATTCAG | GTACTATTTGTTTTCCCTCATCATGAATTTGAGCCGTGATGCTTAT    c.420
 Q  R  S  F  R  |  Y  Y  L  F  S  L  I  M  N  L  S  R  D  A  Y      p.140

          .         .         .         .         .         .       g.11455
 GAGATTCGCCTACTGATGGAGCAAGAGTCTTCTGCTTGTAGCCGGCGACTGAAAGGTTCT       c.480
 E  I  R  L  L  M  E  Q  E  S  S  A  C  S  R  R  L  K  G  S         p.160

          .         .         .         .         .         .       g.11515
 GGAGGAGGAGTCCCAGGAGGAAGTGAAACTGGGGGACTTGGGGGACCAGGGACTCCAGGA       c.540
 G  G  G  V  P  G  G  S  E  T  G  G  L  G  G  P  G  T  P  G         p.180

          .         .         .         .         .         .       g.11575
 GGAGGTCTGCCCCAACTGGCTCTGAAACTTCGGCTGCAAGTCCTGCTCCTGGCTCGAGTC       c.600
 G  G  L  P  Q  L  A  L  K  L  R  L  Q  V  L  L  L  A  R  V         p.200

          .         .         .         .         .         .       g.11635
 CTTAGAGGTCATCCCCCACTTCTGCTAGACGTGGTCAGAAATGCCTGTGATCTCTTCATT       c.660
 L  R  G  H  P  P  L  L  L  D  V  V  R  N  A  C  D  L  F  I         p.220

          .         .         .         .         .         .       g.11695
 CCTCTGGACAAACTAGGCCTCTGGCGCTGTGGCCCTGGGATTGTGGGGCTTTGTGGCCTC       c.720
 P  L  D  K  L  G  L  W  R  C  G  P  G  I  V  G  L  C  G  L         p.240

          .         .         .         .         .         .       g.11755
 GTGTCCTCCATCCTGTCTATTCTCACCCTAATCTATCCCTGGCTACGACTCAAGCCCTGA       c.780
 V  S  S  I  L  S  I  L  T  L  I  Y  P  W  L  R  L  K  P  X         p.259

          .         .         .         .         .         .       g.11815
 ccttccggtacaggataaggaggggacctgaattggtgagatggaatcttagatcgtccc       c.*60

          .         .         .         .         .         .       g.11875
 ccatgtgccagcctcattcgaattctactctttggttaaagttagaaattcagagattta       c.*120

          .         .         .         .         .         .       g.11935
 ggggtggaggaagagctttggggaagatgaggtaaggaaagatgactcgtgaagttaata       c.*180

          .         .         .         .         .         .       g.11995
 ggatgtctctaatttctagatgtgcctgagcttctgttcttttcctctttctttgtgtct       c.*240

          .         .         .         .         .         .       g.12055
 ctcttgaatatatttactttgtgtctcttaactctgtttaaggttctgtgtctatgcatc       c.*300

          .         .         .         .         .         .       g.12115
 tctctctttcttttttcaaccttctcattctcctatccagggatttaatcagcagaatta       c.*360

          .         .         .         .         .         .       g.12175
 ctttttgataggggaggtataaggtttggcctgtaaggttctaactgccttcttttttct       c.*420

          .         .         .         .         .         .       g.12235
 cacagaggtggcttatggcagatttttcctccttcaaactccaaacataatttttaagac       c.*480

          .         .         .         .         .         .       g.12295
 tatgtgccagtggactcttcccttatatctctgcaccacaagttgttggatgtttcctct       c.*540

          .         .         .         .         .         .       g.12355
 tcctcccttatgtctacctcaccaacctcgctcatcatttggcccttatccttccttgta       c.*600

          .         .         .         .         .         .       g.12415
 cacctaccttcagatttctgcttacactttgatttcagagctttattccccagtctgttc       c.*660

          .         .         .         .         .         .       g.12475
 ttactcctttgtcgcttatccagaatgatgctatgtgtagcatcttgctgtaaatcctgt       c.*720

          .         .         .         .         .         .       g.12535
 acaatgattctgtgtaaatagctgtggcctatgccaataatgaagagcaagcctttcagg       c.*780

          .         .         .                                     g.12568
 taagcaaattaaagttcagtttgctcatcgaca                                  c.*813

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Peroxisomal biogenesis factor 11 beta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 27
©2004-2022 Leiden University Medical Center