profilin 1 (PFN1) - coding DNA reference sequence

(used for variant description)

(last modified June 20, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_005022.3 in the PFN1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering PFN1 transcript NM_005022.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5032
                             cccgcagggtccacacgggtcgggccgggcgc       c.-661

 .         .         .         .         .         .                g.5092
 gctcccgtgcagccggctccggccccgaccgccccatgcactcccggccccggcgcaggc       c.-601

 .         .         .         .         .         .                g.5152
 gcaggcgcgggcacacgcgccgccgcccgccggtccttcccttcggcggaggtgggggaa       c.-541

 .         .         .         .         .         .                g.5212
 ggaggagtcatcccgtttaaccctgggctccccgaactctccttaatttgctaaatttgc       c.-481

 .         .         .         .         .         .                g.5272
 agcttgctaattcctcctgctttctccttccttccttcttctggctcactccctgccccg       c.-421

 .         .         .         .         .         .                g.5332
 ataccaaagtctggtttatattcagtgcaaattggagcaaaccctacccttcacctctct       c.-361

 .         .         .         .         .         .                g.5392
 cccgccaccccccatccttctgcattgctttccatcgaactctgcaaattttgcaatagg       c.-301

 .         .         .         .         .         .                g.5452
 gggagggatttttaaaattgcatttgcaaagttcggtgtctgggctggcgagtgggggag       c.-241

 .         .         .         .         .         .                g.5512
 ggagggaatggggagtaggccccgcccctaccgtcctttgcaaataaaaatctagcgggg       c.-181

 .         .         .         .         .         .                g.5572
 cggggggggggaggagcaggaagtggcggtgcgagggctgctgcacagcgagcggagccg       c.-121

 .         .         .         .         .         .                g.5632
 cggtccggacggcagcgcgtgccccgagctctccgcctccccccgcccgccagccgaggc       c.-61

 .         .         .         .         .         .                g.5692
 agctcgagcccagtccgcggccccagcagcagcgccgagagcagccccagtagcagcgcc       c.-1

          .         .         .         .         .         .       g.5752
 ATGGCCGGGTGGAACGCCTACATCGACAACCTCATGGCGGACGGGACCTGTCAGGACGCG       c.60
 M  A  G  W  N  A  Y  I  D  N  L  M  A  D  G  T  C  Q  D  A         p.20

          .         .         .         .         .         .       g.5812
 GCCATCGTGGGCTACAAGGACTCGCCCTCCGTCTGGGCCGCCGTCCCCGGGAAAACGTTC       c.120
 A  I  V  G  Y  K  D  S  P  S  V  W  A  A  V  P  G  K  T  F         p.40

          .   | 02     .         .         .         .         .    g.7314
 GTCAACATCACG | CCAGCTGAGGTGGGTGTCCTGGTTGGCAAAGACCGGTCAAGTTTTTAC    c.180
 V  N  I  T   | P  A  E  V  G  V  L  V  G  K  D  R  S  S  F  Y      p.60

          .         .         .         .         .         .       g.7374
 GTGAATGGGCTGACACTTGGGGGCCAGAAATGTTCGGTGATCCGGGACTCACTGCTGCAG       c.240
 V  N  G  L  T  L  G  G  Q  K  C  S  V  I  R  D  S  L  L  Q         p.80

          .         .         .         .         .         .       g.7434
 GATGGGGAATTTAGCATGGATCTTCGTACCAAGAGCACCGGTGGGGCCCCCACCTTCAAT       c.300
 D  G  E  F  S  M  D  L  R  T  K  S  T  G  G  A  P  T  F  N         p.100

          .         .      | 03  .         .         .         .    g.8124
 GTCACTGTCACCAAGACTGACAAGA | CGCTAGTCCTGCTGATGGGCAAAGAAGGTGTCCAC    c.360
 V  T  V  T  K  T  D  K  T |   L  V  L  L  M  G  K  E  G  V  H      p.120

          .         .         .         .         .         .       g.8184
 GGTGGTTTGATCAACAAGAAATGTTATGAAATGGCCTCCCACCTTCGGCGTTCCCAGTAC       c.420
 G  G  L  I  N  K  K  C  Y  E  M  A  S  H  L  R  R  S  Q  Y         p.140

                                                                    g.8187
 TGA                                                                c.423
 X                                                                  p.140

          .         .         .         .         .         .       g.8247
 cctcgtctgtcccttccccttcaccgctccccacagctttgcacccctttcctccccata       c.*60

          .         .         .         .         .         .       g.8307
 cacacacaaaccattttattttttgggccattaccccataccccttattgctgccaaaac       c.*120

          .         .         .         .         .         .       g.8367
 cacatgggctgggggccagggctggatggacagacacctccccctacccatatccctccc       c.*180

          .         .         .         .         .         .       g.8427
 gtgtgtggttggaaaacttttgttttttggggttttttttttctgaataaaaaagattct       c.*240

          .                                                         g.8437
 actaacaagg                                                         c.*250

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Profilin 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.