phosphatidylinositol glycan anchor biosynthesis, class A (PIGA) - coding DNA reference sequence

(used for variant description)

(last modified June 3, 2013)


This file was created to facilitate the description of sequence variants on transcript NM_002641.3 in the PIGA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009786.1, covering PIGA transcript NM_002641.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .        | 02    g.8564
     gactccggctgcagccgcgggaggtccggacactggcggccatggaactcaccg | gt    c.-61

 .         .         .         .         .         .                g.8624
 aatagaggacacatctcttaactgggttgctctaagaactgatgtctaaaccgtctcagc       c.-1

          .         .         .         .         .         .       g.8684
 ATGGCCTGTAGAGGAGGAGCTGGGAATGGCCACCGTGCCTCAGCTACACTCTCTCGGGTT       c.60
 M  A  C  R  G  G  A  G  N  G  H  R  A  S  A  T  L  S  R  V         p.20

          .         .         .         .         .         .       g.8744
 AGCCCTGGAAGTCTTTACACATGTAGAACCCGTACCCATAATATATGCATGGTATCTGAC       c.120
 S  P  G  S  L  Y  T  C  R  T  R  T  H  N  I  C  M  V  S  D         p.40

          .         .         .         .         .         .       g.8804
 TTTTTCTACCCAAATATGGGAGGCGTGGAAAGCCACATTTACCAGCTCTCTCAGTGCCTG       c.180
 F  F  Y  P  N  M  G  G  V  E  S  H  I  Y  Q  L  S  Q  C  L         p.60

          .         .         .         .         .         .       g.8864
 ATTGAAAGAGGGCATAAGGTTATAATTGTCACCCATGCTTATGGAAATCGAAAAGGCATC       c.240
 I  E  R  G  H  K  V  I  I  V  T  H  A  Y  G  N  R  K  G  I         p.80

          .         .         .         .         .         .       g.8924
 CGTTACCTCACCAGTGGCCTCAAAGTCTATTACTTGCCTCTGAAAGTCATGTACAACCAG       c.300
 R  Y  L  T  S  G  L  K  V  Y  Y  L  P  L  K  V  M  Y  N  Q         p.100

          .         .         .         .         .         .       g.8984
 TCTACAGCCACGACCCTCTTTCACAGTCTGCCATTGCTCAGGTACATATTTGTTCGGGAG       c.360
 S  T  A  T  T  L  F  H  S  L  P  L  L  R  Y  I  F  V  R  E         p.120

          .         .         .         .         .         .       g.9044
 AGAGTCACGATAATCCATTCACATAGTTCTTTTTCTGCTATGGCCCATGATGCTCTCTTC       c.420
 R  V  T  I  I  H  S  H  S  S  F  S  A  M  A  H  D  A  L  F         p.140

          .         .         .         .         .         .       g.9104
 CACGCCAAGACAATGGGGCTTCAGACAGTCTTCACGGACCATTCCCTTTTTGGATTTGCT       c.480
 H  A  K  T  M  G  L  Q  T  V  F  T  D  H  S  L  F  G  F  A         p.160

          .         .         .         .         .         .       g.9164
 GATGTCAGCTCGGTGCTTACAAACAAGCTTCTAACCGTGTCTCTTTGTGATACAAACCAC       c.540
 D  V  S  S  V  L  T  N  K  L  L  T  V  S  L  C  D  T  N  H         p.180

          .         .         .         .         .         .       g.9224
 ATCATTTGTGTGTCTTATACTAGTAAGGAAAATACTGTACTAAGAGCAGCACTGAATCCT       c.600
 I  I  C  V  S  Y  T  S  K  E  N  T  V  L  R  A  A  L  N  P         p.200

          .         .         .         .         .         .       g.9284
 GAAATAGTGTCCGTCATTCCTAATGCTGTAGATCCTACTGACTTCACTCCAGACCCATTT       c.660
 E  I  V  S  V  I  P  N  A  V  D  P  T  D  F  T  P  D  P  F         p.220

          .         .         .         .         .      | 03  .    g.14513
 AGAAGGCATGATAGTATAACTATTGTTGTTGTCAGCAGACTTGTTTACAGAAAAG | GGATC    c.720
 R  R  H  D  S  I  T  I  V  V  V  S  R  L  V  Y  R  K  G |   I      p.240

          .         .         .         .         .         .       g.14573
 GATTTGCTTAGTGGTATAATACCTGAACTCTGTCAGAAATATCCAGATTTAAATTTCATA       c.780
 D  L  L  S  G  I  I  P  E  L  C  Q  K  Y  P  D  L  N  F  I         p.260

          .         .         .         .         .         .       g.14633
 ATTGGAGGAGAGGGACCAAAGAGAATCATTTTGGAAGAAGTTCGGGAAAGATACCAGCTG       c.840
 I  G  G  E  G  P  K  R  I  I  L  E  E  V  R  E  R  Y  Q  L         p.280

          | 04         .         .         .         .         .    g.15454
 CATGACAG | GGTGCGTCTTTTGGGAGCTTTAGAACACAAGGATGTTAGAAATGTCTTAGTT    c.900
 H  D  R  |  V  R  L  L  G  A  L  E  H  K  D  V  R  N  V  L  V      p.300

          .         .         .         .         .         .       g.15514
 CAAGGACATATTTTTCTGAATACCTCCCTTACTGAAGCATTCTGCATGGCGATCGTGGAA       c.960
 Q  G  H  I  F  L  N  T  S  L  T  E  A  F  C  M  A  I  V  E         p.320

          .         .  | 05      .         .         .         .    g.15722
 GCAGCCAGTTGTGGTTTACAG | GTTGTAAGTACCAGAGTTGGTGGAATTCCTGAGGTGCTT    c.1020
 A  A  S  C  G  L  Q   | V  V  S  T  R  V  G  G  I  P  E  V  L      p.340

          .         .         .         .         .         .       g.15782
 CCAGAAAACCTTATTATTTTATGTGAGCCTTCAGTAAAATCTTTGTGTGAAGGATTGGAA       c.1080
 P  E  N  L  I  I  L  C  E  P  S  V  K  S  L  C  E  G  L  E         p.360

          .         .         .         .         .         .       g.15842
 AAGGCTATTTTCCAACTGAAGTCAGGGACATTGCCAGCTCCAGAAAACATCCATAACATA       c.1140
 K  A  I  F  Q  L  K  S  G  T  L  P  A  P  E  N  I  H  N  I         p.380

          .         .         .         .         | 06         .    g.18794
 GTAAAGACTTTCTACACCTGGAGGAATGTTGCAGAAAGAACTGAAAAG | GTATATGACCGG    c.1200
 V  K  T  F  Y  T  W  R  N  V  A  E  R  T  E  K   | V  Y  D  R      p.400

          .         .         .         .         .         .       g.18854
 GTATCAGTGGAAGCTGTGTTGCCAATGGACAAACGACTGGACAGACTTATTTCTCACTGC       c.1260
 V  S  V  E  A  V  L  P  M  D  K  R  L  D  R  L  I  S  H  C         p.420

          .         .         .         .         .         .       g.18914
 GGCCCAGTAACAGGCTACATCTTTGCTTTGTTGGCAGTTTTCAACTTCCTCTTCCTCATT       c.1320
 G  P  V  T  G  Y  I  F  A  L  L  A  V  F  N  F  L  F  L  I         p.440

          .         .         .         .         .         .       g.18974
 TTCTTGAGATGGATGACTCCAGATTCTATCATTGATGTTGCAATAGATGCCACTGGGCCA       c.1380
 F  L  R  W  M  T  P  D  S  I  I  D  V  A  I  D  A  T  G  P         p.460

          .         .         .         .         .         .       g.19034
 CGGGGTGCCTGGACTAATAACTATTCTCACAGTAAAAGAGGGGGTGAGAATAATGAGATA       c.1440
 R  G  A  W  T  N  N  Y  S  H  S  K  R  G  G  E  N  N  E  I         p.480

          .                                                         g.19049
 TCTGAAACCAGGTAG                                                    c.1455
 S  E  T  R  X                                                      p.484

          .         .         .         .         .         .       g.19109
 aaggaagcctagattgtaagattttaaacatttgtaatagttctataaagactatggaaa       c.*60

          .         .         .         .         .         .       g.19169
 ataaccttgcttttggggggtttttgtttttttagagttaatttagtaagttatgctacc       c.*120

          .         .         .         .         .         .       g.19229
 tctatatcattcaatattttctgttgaggaaagataaaaatgtatgcaattcctgagtgt       c.*180

          .         .         .         .         .         .       g.19289
 agaaacttcttgcacttatttaaaatttaggagagaacatttaagccactcaggtatgca       c.*240

          .         .         .         .         .         .       g.19349
 atttttcagactactgaaatccctgtagcagagatgttttaacattatattttgagagct       c.*300

          .         .         .         .         .         .       g.19409
 ttgggtgctgaagggccaaacgttttctgggcattttttggccagtttttaatgtaacac       c.*360

          .         .         .         .         .         .       g.19469
 cattagacactcaccagatgtttacaagttttctttaggggaactacaacaattatatga       c.*420

          .         .         .         .         .         .       g.19529
 actgttttatatcatgttcatatacatttattaggaatctaaatcatgtctttgaacatt       c.*480

          .         .         .         .         .         .       g.19589
 tattaggttcactcagtaggtgttacatgtaattaacaggttccttgagtaagatagtcc       c.*540

          .         .         .         .         .         .       g.19649
 atcagttaccagcacattttgaacccctgctctgtgtagaatgttgaactagatgcttcc       c.*600

          .         .         .         .         .         .       g.19709
 cgccattaaggaccaggggtgcattcactctttgtttaccattcaaatggcttacttcat       c.*660

          .         .         .         .         .         .       g.19769
 cataattgtggttgatatgagatcaatatccaacatgccaaaaatgctcatgccagttaa       c.*720

          .         .         .         .         .         .       g.19829
 tgccaggaaaaaaatcaccgacacactactagtactttgttcctgttgtatgcattctcc       c.*780

          .         .         .         .         .         .       g.19889
 taggtagagcctccatcttcagttgtgtttgtgaaggtattttttgctttttaaatactg       c.*840

          .         .         .         .         .         .       g.19949
 gggaccgatatcactgttgatagtgcagagaaaccctccacatttttcagtgcataattg       c.*900

          .         .         .         .         .         .       g.20009
 agttttctataaatgccttcgtgttttctgagcagaatgtacgaggtgtgccatcccaaa       c.*960

          .         .         .         .         .         .       g.20069
 accagctgctaccctgtccttttaatgtaagtcactccccttcactgtggcctcgctgat       c.*1020

          .         .         .         .         .         .       g.20129
 gtctgataagtattgtcagtgtgcaaaaggctttacttcagaatggtttatttatagcaa       c.*1080

          .         .         .         .         .         .       g.20189
 actaagttgaaaattttagaaacagtctttgtgggtggatgttattaactgtcattgttg       c.*1140

          .         .         .         .         .         .       g.20249
 ttgcccagagccatgggttttttaaccccaaattatccacatggtgtgtattatgaattc       c.*1200

          .         .         .         .         .         .       g.20309
 tttgaactcttaaggtttttgtgagaaaaggactgtgaattcaaaacaataaggcacttg       c.*1260

          .         .         .         .         .         .       g.20369
 tgggtgcactacatagattctgacagtgttgtgattctgtataggatttttaaaaatgac       c.*1320

          .         .         .         .         .         .       g.20429
 aacattcacaaaatttattactttttaaaaaataacatgcctattaactggttgcactga       c.*1380

          .         .         .         .         .         .       g.20489
 tataaaagaaatatatttgtgttttgtttgtactaaaatgcaaaagcaagagtgcaattt       c.*1440

          .         .         .         .         .         .       g.20549
 ttaaaatctagaagttaggggttttgttggagaaaaatggactgatctttaaactattca       c.*1500

          .         .         .         .         .         .       g.20609
 gtcttactgggatttttatgcatagaaactcacatataaacatgaaataaacagtgccag       c.*1560

          .         .         .         .         .         .       g.20669
 tattcataggaaagtgagaaactgtaatatttggccattattctattcaacaggttttag       c.*1620

          .         .         .         .         .         .       g.20729
 aggcatgccaccattttttccttatatttttgcttaatttttttaaattgtcatttaatt       c.*1680

          .         .         .         .         .         .       g.20789
 cttaaactgtcatttatttgagatggaaataagatctaaagttagttgcctttgcctgta       c.*1740

          .         .         .         .         .         .       g.20849
 aaacatgtgatttgcaaattattatttttcttttttttaacaaatggaagtaaatttgtt       c.*1800

          .         .         .         .         .         .       g.20909
 tcacgtaaatcttaattttcaacctttctggataccttaattgtaactgtcagtttgcac       c.*1860

          .         .         .         .         .         .       g.20969
 tggtcggtatatggaaacacattgctctaccctgctacttagttgattttaaagtgaatt       c.*1920

          .         .         .         .         .         .       g.21029
 tacagtgatgagaaatttgtgaaaaatatattgtatttcttttgatgtttcaaaaggttg       c.*1980

          .         .         .         .         .         .       g.21089
 cctatgaaaaactgatttgttaaaacatgctacatgtccaaaaataaagaccagaatgac       c.*2040

          .                                                         g.21104
 attttgataattttc                                                    c.*2055

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Phosphatidylinositol glycan anchor biosynthesis, class A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 05
©2004-2013 Leiden University Medical Center