phosphatidylinositol glycan anchor biosynthesis, class P (PIGP) - coding DNA reference sequence

(used for variant description)

(last modified March 9, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_153681.2 in the PIGP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000021.8, covering PIGP transcript NM_153681.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5391
                         ggaggccacgcttgcagagctggagcgcgcgtctat       c.-181

 .         .         .         .         .         .                g.5451
 cgccccagaacccccctccctgccctatcctccgccaccccttctgttgcggggcgcgcg       c.-121

 .         .         .         .         .         .                g.5511
 ccagcctgggtgtctgtatgcgctcgaggcgggggcgcgggttgcggacggaggcgcggg       c.-61

 .         .         .         .         .         .                g.5571
 aggcggttctgcgcggcgggggccgtacccgcggcggagcgaggaggcgagaatggatca       c.-1

          .         .         .         .         .         .       g.5631
 ATGGTGCCACGGAGCACATCGCTGGCGCTGATTGTGTTCCTTTTCCACAGATTGTCTAAA       c.60
 M  V  P  R  S  T  S  L  A  L  I  V  F  L  F  H  R  L  S  K         p.20

          .         .         .         .         .         .       g.5691
 GCCCCAGGAAAAATGGTGGAAAATTCACCGTCGCCATTGCCAGAAAGAGCGATTTATGGC       c.120
 A  P  G  K  M  V  E  N  S  P  S  P  L  P  E  R  A  I  Y  G         p.40

          .         .         .     | 02   .         .         .    g.8560
 TTTGTTCTTTTCTTAAGCTCCCAATTTGGCTTCA | TACTTTACCTCGTGTGGGCCTTTATT    c.180
 F  V  L  F  L  S  S  Q  F  G  F  I |   L  Y  L  V  W  A  F  I      p.60

          .         .         .         .        | 03.         .    g.10791
 CCTGAATCTTGGCTAAACTCTTTAGGTTTAACCTATTGGCCTCAAAA | ATATTGGGCAGTT    c.240
 P  E  S  W  L  N  S  L  G  L  T  Y  W  P  Q  K  |  Y  W  A  V      p.80

          .         .         .         .         .         .       g.10851
 GCATTACCTGTCTACCTCCTTATTGCTATAGTAATTGGCTACGTGCTCTTGTTTGGGATT       c.300
 A  L  P  V  Y  L  L  I  A  I  V  I  G  Y  V  L  L  F  G  I         p.100

          .         .         .         .       | 04 .         .    g.12460
 AACATGATGAGTACCTCTCCACTCGACTCCATCCATACAATCACAG | ATAACTATGCAAAA    c.360
 N  M  M  S  T  S  P  L  D  S  I  H  T  I  T  D |   N  Y  A  K      p.120

          .         .         .         .         .         .       g.12520
 AATCAACAGCAGAAGAAATACCAAGAGGAGGCCATTCCAGCCTTAAGAGATATTTCTATT       c.420
 N  Q  Q  Q  K  K  Y  Q  E  E  A  I  P  A  L  R  D  I  S  I         p.140

          .         .         .         .         .                 g.12577
 AGTGAAGTAAACCAAATGTTCTTTCTTGCAGCCAAAGAACTTTACACCAAAAACTGA          c.477
 S  E  V  N  Q  M  F  F  L  A  A  K  E  L  Y  T  K  N  X            p.158

          .         .         .         .         .         .       g.12637
 actgtgtgtaaccatagtaacaccaagcacgtatttatttataagtttttgccattataa       c.*60

          .         .         .         .         .         .       g.12697
 ttttgaccataaattaatttgaccatctctcttattaatagagaagtaaaaaatgtaagt       c.*120

          .         .         .         .         .         .       g.12757
 tgaccttctcttagattatgttcaatgaatattgtaaatgttcaagtattgttaatgaat       c.*180

          .         .         .                                     g.12795
 agaataaatacaatattgcattcccatatagcagactt                             c.*218

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Phosphatidylinositol glycan anchor biosynthesis, class P protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.