phosphatidylinositol glycan anchor biosynthesis, class Y (PIGY) - coding DNA reference sequence

(used for variant description)

(last modified November 7, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_001042616.2 in the PIGY gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000004.11, covering PIGY transcript NM_001042616.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5004
                                                         aggg       c.-541

 .         .         .         .         .         .                g.5064
 ggcggggcctgcccggctggcctggacgaacgggaagccgggagctcggccacgggtggc       c.-481

 .         .         .         .         .         .                g.5124
 gaggctgcggtgaggcctggtctccggctgccagaccatgctgagtggagcacgctgcag       c.-421

 .         .         .         .         .         .                g.5184
 gctcgcctcagcgctgcggggaacgcgcgcgccgccgtccgcggtcgcccgtaggtgcct       c.-361

 .         .         .         .         .         .                g.5244
 gcacgcgtcggggtcgcggcctttggccgaccggggcaagaagactgaggagccgccccg       c.-301

 .         .         .         .         .         .                g.5304
 cgacttcgatccggcgctgctggagttcctggtgtgcccgctctccaagaagccgctcag       c.-241

  | 02        .         .         .         .         .             g.6832
  | atatgaagcatcaacaaacgaattgattaatgaagagttgggaatagcttatccaatcat    c.-181

 .         .         .         .         .         .                g.6892
 tgatgggatccctaatatgataccacaggcagctaggatgacacgtcaaagtaagaagca       c.-121

 .         .         .         .         .         .                g.6952
 agaagaagtggagcagcgctagttcataatttaaaaaaattaaaaaaacgcaacagccaa       c.-61

 .         .         .         .         .         .                g.7012
 cttttcttaataccatataccttttaaaacacagtggcaggtaataagtggaagagaaga       c.-1

          .         .         .         .         .         .       g.7072
 ATGTTTCTGTCTCTTCCTACGTTGACTGTTCTTATTCCACTGGTTTCTTTAGCAGGACTG       c.60
 M  F  L  S  L  P  T  L  T  V  L  I  P  L  V  S  L  A  G  L         p.20

          .         .         .         .         .         .       g.7132
 TTCTACTCAGCCTCTGTGGAAGAAAACTTCCCACAGGGCTGCACTAGCACAGCCAGCCTT       c.120
 F  Y  S  A  S  V  E  E  N  F  P  Q  G  C  T  S  T  A  S  L         p.40

          .         .         .         .         .         .       g.7192
 TGCTTTTACAGCCTGCTCTTGCCTATTACCATACCAGTGTATGTATTCTTCCACCTTTGG       c.180
 C  F  Y  S  L  L  L  P  I  T  I  P  V  Y  V  F  F  H  L  W         p.60

          .         .         .                                     g.7228
 ACTTGGATGGGTATTAAACTCTTCAGGCATAATTGA                               c.216
 T  W  M  G  I  K  L  F  R  H  N  X                                 p.71

          .         .         .         .         .         .       g.7288
 tgcaactagagtcaatatgctgtatatattaatgatagctcttgggcatcgatctctgaa       c.*60

          .         .         .         .         .         .       g.7348
 agctcaaatggatggaatttagtttgcgggaaagaggctttgctttgcgcatatcaggct       c.*120

          .         .         .         .         .         .       g.7408
 taggactgtgggaggcttaagttgcagatgcttcttttattgtactcttgttctgccctt       c.*180

          .         .         .         .         .         .       g.7468
 gttttttgaaggctctgacttataactgctgtatcagaagaaacattttgacagtgtctt       c.*240

          .         .         .         .         .         .       g.7528
 ggttggagatgaacatccctaattgacatgtgatgactatttcttattccattcatctaa       c.*300

          .         .         .         .         .         .       g.7588
 gagtcattgaaattttgttttgcttgtttgtttagcttcaaggtctttggtaaagtcaca       c.*360

          .         .         .         .         .         .       g.7648
 tgttaaggatgactgaaataattccaaaggagtgatgttggaatagtccctctaagggag       c.*420

          .         .         .         .         .         .       g.7708
 agaaatgcatttgaacgaatgtgatataaaaccacataatcaaatagaaacttcatgtac       c.*480

          .         .         .         .         .         .       g.7768
 ttacaaaaactgagtttgtaaaattaccttcatttctttgacattaaatgcttatattag       c.*540

          .         .         .         .         .                 g.7824
 caataaacatgttgacactttcctataaaaaataaaccagtttgcagtagtcgttt           c.*596

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Phosphatidylinositol glycan anchor biosynthesis, class Y protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.