PTEN induced putative kinase 1 (PINK1) - coding DNA reference sequence

(used for variant description)

(last modified October 2, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_032409.2 in the PINK1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008164.1, covering PINK1 transcript NM_032409.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5034
                           cgcagaggcaccgccccaagtttgttgtgaccgg       c.-61

 .         .         .         .         .         .                g.5094
 cgggggacgccggtggtggcggcagcggcggctgcgggggcaccgggccgcggcgccacc       c.-1

          .         .         .         .         .         .       g.5154
 ATGGCGGTGCGACAGGCGCTGGGCCGCGGCCTGCAGCTGGGTCGAGCGCTGCTGCTGCGC       c.60
 M  A  V  R  Q  A  L  G  R  G  L  Q  L  G  R  A  L  L  L  R         p.20

          .         .         .         .         .         .       g.5214
 TTCACGGGCAAGCCCGGCCGGGCCTACGGCTTGGGGCGGCCGGGCCCGGCGGCGGGCTGT       c.120
 F  T  G  K  P  G  R  A  Y  G  L  G  R  P  G  P  A  A  G  C         p.40

          .         .         .         .         .         .       g.5274
 GTCCGCGGGGAGCGTCCAGGCTGGGCCGCAGGACCGGGCGCGGAGCCTCGCAGGGTCGGG       c.180
 V  R  G  E  R  P  G  W  A  A  G  P  G  A  E  P  R  R  V  G         p.60

          .         .         .         .         .         .       g.5334
 CTCGGGCTCCCTAACCGTCTCCGCTTCTTCCGCCAGTCGGTGGCCGGGCTGGCGGCGCGG       c.240
 L  G  L  P  N  R  L  R  F  F  R  Q  S  V  A  G  L  A  A  R         p.80

          .         .         .         .         .         .       g.5394
 TTGCAGCGGCAGTTCGTGGTGCGGGCCTGGGGCTGCGCGGGCCCTTGCGGCCGGGCAGTC       c.300
 L  Q  R  Q  F  V  V  R  A  W  G  C  A  G  P  C  G  R  A  V         p.100

          .         .         .         .         .         .       g.5454
 TTTCTGGCCTTCGGGCTAGGGCTGGGCCTCATCGAGGAAAAACAGGCGGAGAGCCGGCGG       c.360
 F  L  A  F  G  L  G  L  G  L  I  E  E  K  Q  A  E  S  R  R         p.120

          .         .        | 02.         .         .         .    g.9420
 GCGGTCTCGGCCTGTCAGGAGATCCAG | GCAATTTTTACCCAGAAAAGCAAGCCGGGGCCT    c.420
 A  V  S  A  C  Q  E  I  Q   | A  I  F  T  Q  K  S  K  P  G  P      p.140

          .         .         .         .         .         .       g.9480
 GACCCGTTGGACACGAGACGCTTGCAGGGCTTTCGGCTGGAGGAGTATCTGATAGGGCAG       c.480
 D  P  L  D  T  R  R  L  Q  G  F  R  L  E  E  Y  L  I  G  Q         p.160

          .         .         .         .         .         .       g.9540
 TCCATTGGTAAGGGCTGCAGTGCTGCTGTGTATGAAGCCACCATGCCTACATTGCCCCAG       c.540
 S  I  G  K  G  C  S  A  A  V  Y  E  A  T  M  P  T  L  P  Q         p.180

          .         .         .         .         .         .       g.9600
 AACCTGGAGGTGACAAAGAGCACCGGGTTGCTTCCAGGGAGAGGCCCAGGTACCAGTGCA       c.600
 N  L  E  V  T  K  S  T  G  L  L  P  G  R  G  P  G  T  S  A         p.200

          .         .         .         .         .         .       g.9660
 CCAGGAGAAGGGCAGGAGCGAGCTCCGGGGGCCCCTGCCTTCCCCTTGGCCATCAAGATG       c.660
 P  G  E  G  Q  E  R  A  P  G  A  P  A  F  P  L  A  I  K  M         p.220

          .      | 03  .         .         .         .         .    g.11482
 ATGTGGAACATCTCG | GCAGGTTCCTCCAGCGAAGCCATCTTGAACACAATGAGCCAGGAG    c.720
 M  W  N  I  S   | A  G  S  S  S  E  A  I  L  N  T  M  S  Q  E      p.240

          .         .         .         .         .       | 04 .    g.16039
 CTGGTCCCAGCGAGCCGAGTGGCCTTGGCTGGGGAGTATGGAGCAGTCACTTACAG | AAAA    c.780
 L  V  P  A  S  R  V  A  L  A  G  E  Y  G  A  V  T  Y  R  |  K      p.260

          .         .         .         .         .         .       g.16099
 TCCAAGAGAGGTCCCAAGCAACTAGCCCCTCACCCCAACATCATCCGGGTTCTCCGCGCC       c.840
 S  K  R  G  P  K  Q  L  A  P  H  P  N  I  I  R  V  L  R  A         p.280

          .         .         .         .         .         .       g.16159
 TTCACCTCTTCCGTGCCGCTGCTGCCAGGGGCCCTGGTCGACTACCCTGATGTGCTGCCC       c.900
 F  T  S  S  V  P  L  L  P  G  A  L  V  D  Y  P  D  V  L  P         p.300

          .         .         .         .         .          | 05    g.17106
 TCACGCCTCCACCCTGAAGGCCTGGGCCATGGCCGGACGCTGTTCCTCGTTATGAAGAA | C    c.960
 S  R  L  H  P  E  G  L  G  H  G  R  T  L  F  L  V  M  K  N  |      p.320

          .         .         .         .         .         .       g.17166
 TATCCCTGTACCCTGCGCCAGTACCTTTGTGTGAACACACCCAGCCCCCGCCTCGCCGCC       c.1020
 Y  P  C  T  L  R  Q  Y  L  C  V  N  T  P  S  P  R  L  A  A         p.340

          .         .         .         .         .         .       g.17226
 ATGATGCTGCTGCAGCTGCTGGAAGGCGTGGACCATCTGGTTCAACAGGGCATCGCGCAC       c.1080
 M  M  L  L  Q  L  L  E  G  V  D  H  L  V  Q  Q  G  I  A  H         p.360

          .         .         .         .    | 06    .         .    g.20067
 AGAGACCTGAAATCCGACAACATCCTTGTGGAGCTGGACCCAG | ACGGCTGCCCCTGGCTG    c.1140
 R  D  L  K  S  D  N  I  L  V  E  L  D  P  D |   G  C  P  W  L      p.380

          .         .         .         .         .         .       g.20127
 GTGATCGCAGATTTTGGCTGCTGCCTGGCTGATGAGAGCATCGGCCTGCAGTTGCCCTTC       c.1200
 V  I  A  D  F  G  C  C  L  A  D  E  S  I  G  L  Q  L  P  F         p.400

          .         .         .         .         .  | 07      .    g.20549
 AGCAGCTGGTACGTGGATCGGGGCGGAAACGGCTGTCTGATGGCCCCAGAG | GTGTCCACG    c.1260
 S  S  W  Y  V  D  R  G  G  N  G  C  L  M  A  P  E   | V  S  T      p.420

          .         .         .         .         .         .       g.20609
 GCCCGTCCTGGCCCCAGGGCAGTGATTGACTACAGCAAGGCTGATGCCTGGGCAGTGGGA       c.1320
 A  R  P  G  P  R  A  V  I  D  Y  S  K  A  D  A  W  A  V  G         p.440

          .         .         .         .         .         .       g.20669
 GCCATCGCCTATGAAATCTTCGGGCTTGTCAATCCCTTCTACGGCCAGGGCAAGGCCCAC       c.1380
 A  I  A  Y  E  I  F  G  L  V  N  P  F  Y  G  Q  G  K  A  H         p.460

          .         .         .         .         .         .       g.20729
 CTTGAAAGCCGCAGCTACCAAGAGGCTCAGCTACCTGCACTGCCCGAGTCAGTGCCTCCA       c.1440
 L  E  S  R  S  Y  Q  E  A  Q  L  P  A  L  P  E  S  V  P  P         p.480

          .         .         .         .         | 08         .    g.21991
 GACGTGAGACAGTTGGTGAGGGCACTGCTCCAGCGAGAGGCCAGCAAG | AGACCATCTGCC    c.1500
 D  V  R  Q  L  V  R  A  L  L  Q  R  E  A  S  K   | R  P  S  A      p.500

          .         .         .         .         .         .       g.22051
 CGAGTAGCCGCAAATGTGCTTCATCTAAGCCTCTGGGGTGAACATATTCTAGCCCTGAAG       c.1560
 R  V  A  A  N  V  L  H  L  S  L  W  G  E  H  I  L  A  L  K         p.520

          .         .         .         .         .         .       g.22111
 AATCTGAAGTTAGACAAGATGGTTGGCTGGCTCCTCCAACAATCGGCCGCCACTTTGTTG       c.1620
 N  L  K  L  D  K  M  V  G  W  L  L  Q  Q  S  A  A  T  L  L         p.540

          .         .         .         .         .         .       g.22171
 GCCAACAGGCTCACAGAGAAGTGTTGTGTGGAAACAAAAATGAAGATGCTCTTTCTGGCT       c.1680
 A  N  R  L  T  E  K  C  C  V  E  T  K  M  K  M  L  F  L  A         p.560

          .         .         .         .         .         .       g.22231
 AACCTGGAGTGTGAAACGCTCTGCCAGGCAGCCCTCCTCCTCTGCTCATGGAGGGCAGCC       c.1740
 N  L  E  C  E  T  L  C  Q  A  A  L  L  L  C  S  W  R  A  A         p.580

                                                                    g.22237
 CTGTGA                                                             c.1746
 L  X                                                               p.581

          .         .         .         .         .         .       g.22297
 tgtccctgcatggagctggtgaattactaaaagaacatggcatcctctgtgtcgtgatgg       c.*60

          .         .         .         .         .         .       g.22357
 tctgtgaatggtgagggtgggagtcaggagacaagacagcgcagagagggctggttagcc       c.*120

          .         .         .         .         .         .       g.22417
 ggaaaaggcctcgggcttggcaaatggaagaacttgagtgagagttcagtctgcagtcct       c.*180

          .         .         .         .         .         .       g.22477
 ctgctcacagacatctgaaaagtgaatggccaagctggtctagtagatgaggctggactg       c.*240

          .         .         .         .         .         .       g.22537
 aggaggggtaggcctgcatccacagagaggatccaggccaaggcactggctgtcagtggc       c.*300

          .         .         .         .         .         .       g.22597
 agagtttggctgtgacctttgcccctaacacgaggaactcgtttgaagggggcagcgtag       c.*360

          .         .         .         .         .         .       g.22657
 catgtctgatttgccacctggatgaaggcagacatcaacatgggtcagcacgttcagtta       c.*420

          .         .         .         .         .         .       g.22717
 cgggagtgggaaattacatgaggcctgggcctctgcgttcccaagctgtgcgttctggac       c.*480

          .         .         .         .         .         .       g.22777
 cagctactgaattattaatctcacttagcgaaagtgacggatgagcagtaagtaagtaag       c.*540

          .         .         .         .         .         .       g.22837
 tgtggggatttaaacttgagggtttccctcctgactagcctctcttacaggaattgtgaa       c.*600

          .         .         .         .         .         .       g.22897
 atattaaatgcaaatttacaactgcagatgacgtatgtgccttgaactgaatatttggct       c.*660

          .         .         .         .         .         .       g.22957
 ttaagaatgattcttatactctgaaggtgagaatattttgtgggcaggtatcaacattgg       c.*720

          .         .         .         .         .         .       g.23017
 ggaagagatttcatgtctaactaactaactttatacatgatttttaggaagctattgcct       c.*780

          .         .         .         .                           g.23057
 aaatcagcgtcaacatgcagtaaaggttgtcttcaactga                           c.*820

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The PTEN induced putative kinase 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 24b
©2004-2020 Leiden University Medical Center