polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 (PKHD1L1) - 342 nt intron 75 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.165474
gtaagtcataactcaaaattttacttaagtgaaggaattaagctacaaattctgaaggat  c.12330+60

         .         .         .         .         .         .  g.165534
gagccagtttcactcatcctggtgtgctggcagcctgaggatcacacggccctttcagaa  c.12330+120

         .         .         .         .         .   g.165585
gttggactaatatccaaggataccatcttgtaatgtctcaaaaatgtttat  c.12330+171

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.165636
         gttaaacgaacttctgctgctcaggtttatgaactctttgtgtggaataag  c.12331-121

.         .         .         .         .         .           g.165696
gagcttctgcagattttcaatttataatgaggcatttttaaaaataaagttttgcatata  c.12331-61

.         .         .         .         .         .           g.165756
tttttaaaagcatggaaacaggacaattgttataattatctactttttttttttttttag  c.12331-1


Powered by LOVD v.3.0 Build 29
©2004-2023 Leiden University Medical Center