plakophilin 2 (PKP2) - coding DNA reference sequence

(used for variant description)

(last modified March 30, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_004572.3 in the PKP2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering PKP2 transcript NM_004572.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5055
      aggggcggggccggactcgagcggggcggggctcgcgccagcgcccccagctccg       c.-61

 .         .         .         .         .         .                g.5115
 tggcggcttcgcccgcgagtccagaggcaggcgagcagctcggtcgcccccaccggcccc       c.-1

          .         .         .         .         .         .       g.5175
 ATGGCAGCCCCCGGCGCCCCAGCTGAGTACGGCTACATCCGGACCGTCCTGGGCCAGCAG       c.60
 M  A  A  P  G  A  P  A  E  Y  G  Y  I  R  T  V  L  G  Q  Q         p.20

          .         .         .         .         .         .       g.5235
 ATCCTGGGACAACTGGACAGCTCCAGCCTGGCGCTGCCCTCCGAGGCCAAGCTGAAGCTG       c.120
 I  L  G  Q  L  D  S  S  S  L  A  L  P  S  E  A  K  L  K  L         p.40

          .         .         .         .         .         .       g.5295
 GCGGGGAGCAGCGGCCGCGGCGGCCAGACAGTCAAGAGCCTGCGGATCCAGGAGCAGGTG       c.180
 A  G  S  S  G  R  G  G  Q  T  V  K  S  L  R  I  Q  E  Q  V         p.60

          .         .         .         .    | 02    .         .    g.22831
 CAGCAGACCCTCGCCCGGAAGGGCCGCAGCTCCGTGGGCAACG | GAAATCTTCACCGAACC    c.240
 Q  Q  T  L  A  R  K  G  R  S  S  V  G  N  G |   N  L  H  R  T      p.80

          .         .         .         .         .         .       g.22891
 AGCAGTGTTCCTGAGTATGTCTACAACCTACACTTGGTTGAAAATGATTTTGTTGGAGGC       c.300
 S  S  V  P  E  Y  V  Y  N  L  H  L  V  E  N  D  F  V  G  G         p.100

          .         .         .       | 03 .         .         .    g.23327
 CGTTCCCCTGTTCCTAAAACCTATGACATGCTAAAG | GCTGGCACAACTGCCACTTATGAA    c.360
 R  S  P  V  P  K  T  Y  D  M  L  K   | A  G  T  T  A  T  Y  E      p.120

          .         .         .         .         .         .       g.23387
 GGTCGCTGGGGAAGAGGAACAGCACAGTACAGCTCCCAGAAGTCCGTGGAAGAAAGGTCC       c.420
 G  R  W  G  R  G  T  A  Q  Y  S  S  Q  K  S  V  E  E  R  S         p.140

          .         .         .         .         .         .       g.23447
 TTGAGGCATCCTCTGAGGAGACTGGAGATTTCTCCTGACAGCAGCCCGGAGAGGGCTCAC       c.480
 L  R  H  P  L  R  R  L  E  I  S  P  D  S  S  P  E  R  A  H         p.160

          .         .         .         .         .         .       g.23507
 TACACGCACAGCGATTACCAGTACAGCCAGAGAAGCCAGGCTGGGCACACCCTGCACCAC       c.540
 Y  T  H  S  D  Y  Q  Y  S  Q  R  S  Q  A  G  H  T  L  H  H         p.180

          .         .         .         .         .         .       g.23567
 CAAGAAAGCAGGCGGGCCGCCCTCCTAGTGCCACCGAGATATGCTCGTTCCGAGATCGTG       c.600
 Q  E  S  R  R  A  A  L  L  V  P  P  R  Y  A  R  S  E  I  V         p.200

          .         .         .         .         .         .       g.23627
 GGGGTCAGCCGTGCTGGCACCACAAGCAGGCAGCGCCACTTTGACACATACCACAGACAG       c.660
 G  V  S  R  A  G  T  T  S  R  Q  R  H  F  D  T  Y  H  R  Q         p.220

          .         .         .         .         .         .       g.23687
 TACCAGCATGGCTCTGTTAGCGACACCGTTTTTGACAGCATCCCTGCCAACCCGGCCCTG       c.720
 Y  Q  H  G  S  V  S  D  T  V  F  D  S  I  P  A  N  P  A  L         p.240

          .         .         .         .         .         .       g.23747
 CTCACGTACCCCAGGCCAGGGACCAGCCGCAGCATGGGCAACCTCTTGGAGAAGGAGAAC       c.780
 L  T  Y  P  R  P  G  T  S  R  S  M  G  N  L  L  E  K  E  N         p.260

          .         .         .         .         .         .       g.23807
 TACCTGACGGCAGGGCTCACTGTCGGGCAGGTCAGGCCGCTGGTGCCCCTGCAGCCCGTC       c.840
 Y  L  T  A  G  L  T  V  G  Q  V  R  P  L  V  P  L  Q  P  V         p.280

          .         .         .         .         .         .       g.23867
 ACTCAGAACAGGGCTTCCAGGTCCTCCTGGCATCAGAGCTCCTTCCACAGCACCCGCACG       c.900
 T  Q  N  R  A  S  R  S  S  W  H  Q  S  S  F  H  S  T  R  T         p.300

          .         .         .         .         .         .       g.23927
 CTGAGGGAAGCTGGGCCCAGTGTCGCCGTGGATTCCAGCGGGAGGAGAGCGCACTTGACT       c.960
 L  R  E  A  G  P  S  V  A  V  D  S  S  G  R  R  A  H  L  T         p.320

          .         .         .         .         .         .       g.23987
 GTCGGCCAGGCGGCCGCAGGGGGAAGTGGGAATCTGCTCACTGAGAGAAGCACTTTCACT       c.1020
 V  G  Q  A  A  A  G  G  S  G  N  L  L  T  E  R  S  T  F  T         p.340

          .     | 04   .         .         .         .         .    g.32830
 GACTCCCAGCTGGG | GAATGCAGACATGGAGATGACTCTGGAGCGAGCAGTGAGTATGCTC    c.1080
 D  S  Q  L  G  |  N  A  D  M  E  M  T  L  E  R  A  V  S  M  L      p.360

          .         .         .         .         .         .       g.32890
 GAGGCAGACCACATGCTGCCATCCAGGATTTCTGCTGCAGCTACTTTCATACAGCACGAG       c.1140
 E  A  D  H  M  L  P  S  R  I  S  A  A  A  T  F  I  Q  H  E         p.380

          .         .         . | 05       .         .         .    g.50903
 TGCTTCCAGAAATCTGAAGCTCGGAAGAGG | GTTAACCAGCTTCGTGGCATCCTCAAGCTT    c.1200
 C  F  Q  K  S  E  A  R  K  R   | V  N  Q  L  R  G  I  L  K  L      p.400

          .         .         .         .         .         .       g.50963
 CTGCAGCTCCTAAAAGTTCAGAATGAAGACGTTCAGCGAGCTGTGTGTGGGGCCTTGAGA       c.1260
 L  Q  L  L  K  V  Q  N  E  D  V  Q  R  A  V  C  G  A  L  R         p.420

          .         .         .         .         .         .       g.51023
 AACTTAGTATTTGAAGACAATGACAACAAATTGGAGGTGGCTGAACTAAATGGGGTACCT       c.1320
 N  L  V  F  E  D  N  D  N  K  L  E  V  A  E  L  N  G  V  P         p.440

          .         .         .         .         .         | 06    g.58535
 CGGCTGCTCCAGGTGCTGAAGCAAACCAGAGACTTGGAGACTAAAAAACAAATAACAG | AC    c.1380
 R  L  L  Q  V  L  K  Q  T  R  D  L  E  T  K  K  Q  I  T  D |       p.460

          .         .         .         .         .         .       g.58595
 CATACAGTCAATTTAAGAAGTAGGAATGGCTGGCCGGGCGCGGTGGCTCACGCCTGTAAT       c.1440
 H  T  V  N  L  R  S  R  N  G  W  P  G  A  V  A  H  A  C  N         p.480

          .         .         .         .         .         .       g.58655
 CCCAGCACTTTGGGAGGCCAAGGCGGGCGGATCACGAGGTCAGGAGTTCGAGACCAGCCT       c.1500
 P  S  T  L  G  G  Q  G  G  R  I  T  R  S  G  V  R  D  Q  P         p.500

          . | 07       .         .         .         .         .    g.60691
 GACCAACATG | GTTTGCTGTGGAATTTGTCATCTAATGACAAACTCAAGAATCTCATGATA    c.1560
 D  Q  H  G |   L  L  W  N  L  S  S  N  D  K  L  K  N  L  M  I      p.520

          .         .         .         .         .         .       g.60751
 ACAGAAGCATTGCTTACGCTGACGGAGAATATCATCATCCCCTTTTCTGGGTGGCCTGAA       c.1620
 T  E  A  L  L  T  L  T  E  N  I  I  I  P  F  S  G  W  P  E         p.540

          .         .         .         .         .         .       g.60811
 GGAGACTACCCAAAAGCAAATGGTTTGCTCGATTTTGACATATTCTACAACGTCACTGGA       c.1680
 G  D  Y  P  K  A  N  G  L  L  D  F  D  I  F  Y  N  V  T  G         p.560

          | 08         .         .         .         .         .    g.77736
 TGCCTAAG | AAACATGAGTTCTGCTGGCGCTGATGGGAGAAAAGCGATGAGAAGATGTGAC    c.1740
 C  L  R  |  N  M  S  S  A  G  A  D  G  R  K  A  M  R  R  C  D      p.580

          .         .         .         .         .         .       g.77796
 GGACTCATTGACTCACTGGTCCATTATGTCAGAGGAACCATTGCAGATTACCAGCCAGAT       c.1800
 G  L  I  D  S  L  V  H  Y  V  R  G  T  I  A  D  Y  Q  P  D         p.600

        | 09 .         .         .         .         .         .    g.79269
 GACAAG | GCCACGGAGAATTGTGTGTGCATTCTTCATAACCTCTCCTACCAGCTGGAGGCA    c.1860
 D  K   | A  T  E  N  C  V  C  I  L  H  N  L  S  Y  Q  L  E  A      p.620

          .         .         .         .         .         .       g.79329
 GAGCTCCCAGAGAAATATTCCCAGAATATCTATATTCAAAACCGGAATATCCAGACTGAC       c.1920
 E  L  P  E  K  Y  S  Q  N  I  Y  I  Q  N  R  N  I  Q  T  D         p.640

          .         .         .         .         .  | 10      .    g.80326
 AACAACAAAAGTATTGGATGTTTTGGCAGTCGAAGCAGGAAAGTAAAAGAG | CAATACCAG    c.1980
 N  N  K  S  I  G  C  F  G  S  R  S  R  K  V  K  E   | Q  Y  Q      p.660

          .         .         .         .         .         .       g.80386
 GACGTGCCGATGCCGGAGGAAAAGAGCAACCCCAAGGGCGTGGAGTGGCTGTGGCATTCC       c.2040
 D  V  P  M  P  E  E  K  S  N  P  K  G  V  E  W  L  W  H  S         p.680

          .         .         .         .         .         .       g.80446
 ATTGTTATAAGGATGTATCTGTCCTTGATCGCCAAAAGTGTCCGCAACTACACACAAGAA       c.2100
 I  V  I  R  M  Y  L  S  L  I  A  K  S  V  R  N  Y  T  Q  E         p.700

          .         .         .         .      | 11  .         .    g.99305
 GCATCCTTAGGAGCTCTGCAGAACCTCACGGCCGGAAGTGGACCA | ATGCCGACATCAGTG    c.2160
 A  S  L  G  A  L  Q  N  L  T  A  G  S  G  P   | M  P  T  S  V      p.720

          .         .         .         .         .         .       g.99365
 GCTCAGACAGTTGTCCAGAAGGAAAGTGGCCTGCAGCACACCCGAAAGATGCTGCATGTT       c.2220
 A  Q  T  V  V  Q  K  E  S  G  L  Q  H  T  R  K  M  L  H  V         p.740

          .         .         .         .         .         .       g.99425
 GGTGACCCAAGTGTGAAAAAGACAGCCATCTCGCTGCTGAGGAATCTGTCCCGGAATCTT       c.2280
 G  D  P  S  V  K  K  T  A  I  S  L  L  R  N  L  S  R  N  L         p.760

          .          | 12        .         .         .         .    g.105589
 TCTCTGCAGAATGAAATTG | CCAAAGAAACTCTCCCTGATTTGGTTTCCATCATTCCTGAC    c.2340
 S  L  Q  N  E  I  A |   K  E  T  L  P  D  L  V  S  I  I  P  D      p.780

          .         .         .         .         .         .       g.105649
 ACAGTCCCGAGTACTGACCTTCTCATTGAAACTACAGCCTCTGCCTGTTACACATTGAAC       c.2400
 T  V  P  S  T  D  L  L  I  E  T  T  A  S  A  C  Y  T  L  N         p.800

          .         .         .         .         .         .       g.105709
 AACATAATCCAAAACAGTTACCAGAATGCACGCGACCTTCTAAACACCGGGGGCATCCAG       c.2460
 N  I  I  Q  N  S  Y  Q  N  A  R  D  L  L  N  T  G  G  I  Q         p.820

          .         .          | 13        .         .         .    g.109146
 AAAATTATGGCCATTAGTGCAGGCGATGC | CTATGCCTCCAACAAAGCAAGTAAAGCTGCT    c.2520
 K  I  M  A  I  S  A  G  D  A  |  Y  A  S  N  K  A  S  K  A  A      p.840

          .         .         .         .         .        | 14.    g.109357
 TCCGTCCTTCTGTATTCTCTGTGGGCACACACGGAACTGCATCATGCCTACAAGAAG | GCT    c.2580
 S  V  L  L  Y  S  L  W  A  H  T  E  L  H  H  A  Y  K  K   | A      p.860

          .         .         .         .         .         .       g.109417
 CAGTTTAAGAAGACAGATTTTGTCAACAGCCGGACTGCCAAAGCCTACCACTCCCTTAAA       c.2640
 Q  F  K  K  T  D  F  V  N  S  R  T  A  K  A  Y  H  S  L  K         p.880

                                                                    g.109423
 GACTGA                                                             c.2646
 D  X                                                               p.881

          .         .         .         .         .         .       g.109483
 ggaaaatgacaaagtattctcggctgcaaaaatccccaaaggaaaacacctatttttcta       c.*60

          .         .         .         .         .         .       g.109543
 ctacccagcccaagaaacctcaaaagcatgccttgtttctatccttctctatttccgtgg       c.*120

          .         .         .         .         .         .       g.109603
 tcccctgaatccagaaaacaaatagaacataattttatgagtcttccagaagacctttgc       c.*180

          .         .         .         .         .         .       g.109663
 aagtttgccaccagtagataccggccacaggctcgacaaatagtggtctttgttattagg       c.*240

          .         .         .         .         .         .       g.109723
 gcttatggtacatggcttcctggaatcaaaatgtgaattcatgtggaagggacattaatc       c.*300

          .         .         .         .         .         .       g.109783
 caataaataaggaaagaagctgttgcattactgggattttaaaagtttgatttacattta       c.*360

          .         .         .         .         .         .       g.109843
 tattccttttctggttcccatgttttgtcactcatgtgcacattgcttcgccattgggcc       c.*420

          .         .         .         .         .         .       g.109903
 tccagtgtattgttctgcagtgttgaaacagaatggaaatgacaagaaatatctgcagtt       c.*480

          .         .         .         .         .         .       g.109963
 atccaggagaaagtataatggcaaaattattggtttctttctttactttgtgcttgtttt       c.*540

          .         .         .         .         .         .       g.110023
 tatccccttgggttgtttttctctgatttttaaataaacttaagaaatttagattacaga       c.*600

          .         .         .         .         .         .       g.110083
 gtatgcatgactgtaagaaaaagaaattgagaggaagtgatcatagcaaattaaagaagt       c.*660

          .         .         .         .         .         .       g.110143
 cttttcctcccagaacttaaagtaaaataaaaaataaataaataaataaaatcttttcca       c.*720

          .         .         .         .         .         .       g.110203
 cagagaaaggcaactgtgatgataaaatttaacgttcccccaaacactgagtcaatgaga       c.*780

          .         .         .         .         .         .       g.110263
 tttttctcaggagatactttacctataacaacgccgttaaatccaaatctcttctaaacg       c.*840

          .         .         .         .         .         .       g.110323
 atggcattctatgtaatgcctttcctggacttttttggccactgccctggactagtgaaa       c.*900

          .         .         .         .         .         .       g.110383
 gaatggactctatctttatctgcaagaggaactaaggccttctctcagactgcctggcca       c.*960

          .         .         .         .         .         .       g.110443
 gcctggggcactgaaaatacggctcatgttaatgagttacattatcagccagcccagcct       c.*1020

          .         .         .         .         .         .       g.110503
 tgcccaccatttaagaaatatcacagagccactagatctcatatgatcttcttcaagcca       c.*1080

          .         .         .         .         .         .       g.110563
 ttattttaactcaagaaaactctagagaagaaaagtgaagaagtcatgttgaagaagatg       c.*1140

          .         .         .         .         .         .       g.110623
 taagaatgtgtcaagaccatccagaaatgatatgagaaatactgatattttaaatggttg       c.*1200

          .         .         .         .         .         .       g.110683
 acatcatccagcgaaatgaatctacattaaatgttgttttaactgcgctatgattaaaac       c.*1260

          .         .         .         .         .         .       g.110743
 cattcatatagagttagtctttacaactactattctgttatttttttttttaatctgaca       c.*1320

          .         .         .         .         .         .       g.110803
 acatttgtcctaagtaagataagcaaaaaaattcttcaactccttttggcaagaaaactg       c.*1380

          .         .         .         .         .         .       g.110863
 taacagaaaataaattttgaatgtgtacttaagtctttattatatttgaagcaatttttt       c.*1440

          .         .         .         .         .         .       g.110923
 ttcaattttaaaagctgaatgaagacaacttaggttgctaacctagttcaaaatgaaatt       c.*1500

          .         .         .         .         .         .       g.110983
 atttagataccaatttttaaaatactggagagaatttatatgtctttttccagagttctg       c.*1560

          .         .         .         .         .         .       g.111043
 atgataagcatttggagtgcatttattcctccagataataaatgtgtgttcagaactttt       c.*1620

          .         .         .         .         .                 g.111101
 tgtgttttttaaggcattaataaagccttcgataatattaaatacaaaatgagaccaa         c.*1678

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Plakophilin 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 09
©2004-2014 Leiden University Medical Center