phospholipase A2, group V (PLA2G5) - coding DNA reference sequence

(used for variant description)

(last modified November 25, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_000929.2 in the PLA2G5 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032045.1, covering PLA2G5 transcript NM_000929.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 cagggttctacccggctgggtccaggca       c.-241

 .         .         .         .         .         .                g.5088
 gaagtttttcctccccacctccgggtttgtcctcatcatcggtcactcccattcacagct       c.-181

 .         .         .         .         .         .                g.5148
 ttaagattctggaggccaagaatttgactccccccggatccatggtctgtggataccaat       c.-121

 .         .         .         .         .         .                g.5208
 gttccgactggagacggggagcccgcgagacccgggtctccagggtctgcccaaggaagt       c.-61

 .         .         .         .         .          | 02            g.19623
 tgctcatgggagcagacctctagagcaggatttgaggccaggccaaagag | aaccccagag    c.-1

          .         .         .         . | 03       .         .    g.20895
 ATGAAAGGCCTCCTCCCACTGGCTTGGTTCCTGGCTTGTA | GTGTGCCTGCTGTGCAAGGA    c.60
 M  K  G  L  L  P  L  A  W  F  L  A  C  S |   V  P  A  V  Q  G      p.20

          .         .         .         .         .         .       g.20955
 GGCTTGCTGGACCTAAAATCAATGATCGAGAAGGTGACAGGGAAGAACGCCCTGACAAAC       c.120
 G  L  L  D  L  K  S  M  I  E  K  V  T  G  K  N  A  L  T  N         p.40

          .         .         .         .         .         .       g.21015
 TACGGCTTCTACGGCTGTTACTGCGGCTGGGGCGGCCGAGGAACCCCCAAGGATGGCACC       c.180
 Y  G  F  Y  G  C  Y  C  G  W  G  G  R  G  T  P  K  D  G  T         p.60

       | 04  .         .         .         .         .         .    g.24636
 GATTG | GTGCTGTTGGGCGCATGACCACTGCTATGGGCGGCTGGAGGAGAAGGGCTGCAAC    c.240
 D  W  |  C  C  W  A  H  D  H  C  Y  G  R  L  E  E  K  G  C  N      p.80

          .         .         .         .         .   | 05     .    g.25368
 ATTCGCACACAGTCCTACAAATACAGATTCGCGTGGGGCGTGGTCACCTGCG | AGCCCGGG    c.300
 I  R  T  Q  S  Y  K  Y  R  F  A  W  G  V  V  T  C  E |   P  G      p.100

          .         .         .         .         .         .       g.25428
 CCCTTCTGCCATGTGAACCTCTGTGCCTGTGACCGGAAGCTCGTCTACTGCCTCAAGAGA       c.360
 P  F  C  H  V  N  L  C  A  C  D  R  K  L  V  Y  C  L  K  R         p.120

          .         .         .         .         .                 g.25485
 AACCTACGGAGCTACAACCCACAGTACCAATACTTTCCCAACATCCTCTGCTCCTAG          c.417
 N  L  R  S  Y  N  P  Q  Y  Q  Y  F  P  N  I  L  C  S  X            p.138

          .         .         .         .         .         .       g.25545
 gcctccccagcgagctcctcccagaccaagacttttgttctgtttttctacaacacagag       c.*60

          .         .         .         .         .         .       g.25605
 tactgactctgcctggttcctgagagaggctcctaagtcacagacctcagtctttctcga       c.*120

          .         .         .         .         .         .       g.25665
 agcttggcggacccccagggccacactgtaccctccagcgagtcccaggagagtgactct       c.*180

          .         .         .         .         .         .       g.25725
 ggtcataggacttggtagggtcccagggtccctaggcctccacttctgagggcagcccct       c.*240

          .         .         .         .         .         .       g.25785
 ctggtgccaagagctctcctccaactcagggttggctgtgtctcttttcttctctgaaga       c.*300

          .         .         .         .         .         .       g.25845
 cagcgtcctggctccagttggaacactttcctgagatgcacttacttctcagcttctgcg       c.*360

          .         .         .         .         .         .       g.25905
 atcagattatcatcaccaccaccctccagagaatttttacgcaagaagagccaaattgac       c.*420

          .         .         .         .         .         .       g.25965
 tctctaaatctggtgtatgggtattaaataaaattcattctcaaggctaataaaaaccac       c.*480

          .         .         .         .         .         .       g.26025
 attggcattttcctctgctgtgggggatcgctggtgcctctttctctgccactggggcaa       c.*540

          .         .         .         .         .         .       g.26085
 taaacccaaagatgtctacattatctccgaaacagaagggaagattagtaaatgcagggt       c.*600

          .         .         .         .         .         .       g.26145
 tttctgggatgagcttcaggctttctcttgggctaattttcttacaccttggggtcctct       c.*660

          .         .         .         .         .         .       g.26205
 ccagtattgggtctcattcttcctcgatggggtcagggaaagataactggtgattatgcc       c.*720

          .         .         .         .         .         .       g.26265
 agcttcagcttccaggccagagagggtggcattcaaatcccagtgctggcttcttcagct       c.*780

          .         .         .         .         .         .       g.26325
 gtgtggtcttggacccgttactgaacctctttgactttcagtctctttgagaaataaact       c.*840

          .         .         .         .         .         .       g.26385
 gtcttgttccttgcaatgtaaaatgagacttctaaagcccaccttgatgctgatatggag       c.*900

          .         .         .         .         .         .       g.26445
 aatgctgaggttctaggatttcacacagcaggaatttttttttaataggtgtcagctgtg       c.*960

          .         .         .         .         .         .       g.26505
 gggtttattttttacaaagtaaggacattaaaaaaaccaacccgtctatcaattcataaa       c.*1020

          .         .         .         .         .         .       g.26565
 agaaaggatgttctgataccaagactgaaagaagaaaggatgtattccaaaacaaaggaa       c.*1080

          .         .         .         .         .         .       g.26625
 catccttccaagaaaggacctatggcttctttattccgacataccccaaaataactgcat       c.*1140

          .         .         .         .         .         .       g.26685
 gataaataggtctatatttaaaaagctctagtgtcgaatgttttcaaaataaaatttaat       c.*1200

                                                                    g.26694
 tttatgaga                                                          c.*1209

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Phospholipase A2, group V protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.