phospholipase A2, group VI (cytosolic, calcium-independent) (PLA2G6) - coding DNA reference sequence

(used for variant description)

(last modified June 28, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_003560.2 in the PLA2G6 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007094.2, covering PLA2G6 transcript NM_003560.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.28952
                                             gggggtccgttcccca       c.-121

 .         .         .         .         .         .                g.29012
 acttcctcggcgctccggactcccaagtctccgccggaccctcctttggatattcctcgt       c.-61

 .         .     | 02   .         .         .         .             g.41264
 gtctccgattctgag | acagagggggaagacggtggggcctccccacctgccccgcagaag    c.-1

          .         .         .         .         .         .       g.41324
 ATGCAGTTCTTTGGCCGCCTGGTCAATACCTTCAGTGGCGTCACCAACTTGTTCTCTAAC       c.60
 M  Q  F  F  G  R  L  V  N  T  F  S  G  V  T  N  L  F  S  N         p.20

          .         .         .         .         .         .       g.41384
 CCATTCCGGGTGAAGGAGGTGGCTGTGGCCGACTACACCTCGAGTGACCGAGTTCGGGAG       c.120
 P  F  R  V  K  E  V  A  V  A  D  Y  T  S  S  D  R  V  R  E         p.40

          .         .         .         .         .         .       g.41444
 GAAGGGCAGCTGATTCTGTTCCAGAACACTCCCAACCGCACCTGGGACTGCGTCCTGGTC       c.180
 E  G  Q  L  I  L  F  Q  N  T  P  N  R  T  W  D  C  V  L  V         p.60

          .         .          | 03        .         .         .    g.65068
 AACCCCAGGAACTCACAGAGTGGATTCCG | ACTCTTCCAGCTGGAGTTGGAGGCTGACGCC    c.240
 N  P  R  N  S  Q  S  G  F  R  |  L  F  Q  L  E  L  E  A  D  A      p.80

          .         .         .         .         .         .       g.65128
 CTAGTGAATTTCCATCAGTATTCTTCCCAGCTGCTACCCTTCTATGAGAGCTCCCCTCAG       c.300
 L  V  N  F  H  Q  Y  S  S  Q  L  L  P  F  Y  E  S  S  P  Q         p.100

          .         .         .         .         .         .       g.65188
 GTCCTGCACACTGAGGTCCTGCAGCACCTGACCGACCTCATCCGTAACCACCCCAGCTGG       c.360
 V  L  H  T  E  V  L  Q  H  L  T  D  L  I  R  N  H  P  S  W         p.120

          .         .         .         .         .         .       g.65248
 TCAGTGGCCCACCTGGCTGTGGAGCTAGGGATCCGCGAGTGCTTCCATCACAGCCGTATC       c.420
 S  V  A  H  L  A  V  E  L  G  I  R  E  C  F  H  H  S  R  I         p.140

       | 04  .         .         .         .         .         .    g.67457
 ATCAG | CTGTGCCAATTGCGCGGAGAACGAGGAGGGCTGCACACCCCTGCACCTGGCCTGC    c.480
 I  S  |  C  A  N  C  A  E  N  E  E  G  C  T  P  L  H  L  A  C      p.160

          .         .         .         .         .         .       g.67517
 CGCAAGGGTGATGGGGAGATCCTGGTGGAGCTGGTGCAGTACTGCCACACTCAGATGGAT       c.540
 R  K  G  D  G  E  I  L  V  E  L  V  Q  Y  C  H  T  Q  M  D         p.180

          .         .         .         .         .         .       g.67577
 GTCACCGACTACAAGGGAGAGACCGTCTTCCATTATGCTGTCCAGGGTGACAATTCTCAG       c.600
 V  T  D  Y  K  G  E  T  V  F  H  Y  A  V  Q  G  D  N  S  Q         p.200

           | 05        .         .         .         .         .    g.70572
 GTGCTGCAG | CTCCTTGGAAGGAACGCAGTGGCTGGCCTGAACCAGGTGAATAACCAAGGG    c.660
 V  L  Q   | L  L  G  R  N  A  V  A  G  L  N  Q  V  N  N  Q  G      p.220

          .         .         .         .         .         .       g.70632
 CTGACCCCGCTGCACCTGGCCTGCCAGCTGGGGAAGCAGGAGATGGTCCGCGTGCTGCTG       c.720
 L  T  P  L  H  L  A  C  Q  L  G  K  Q  E  M  V  R  V  L  L         p.240

          .         .         .         .         .         .       g.70692
 CTGTGCAATGCTCGGTGCAACATCATGGGCCCCAACGGCTACCCCATCCACTCGGCCATG       c.780
 L  C  N  A  R  C  N  I  M  G  P  N  G  Y  P  I  H  S  A  M         p.260

          .        | 06.         .         .         .         .    g.75649
 AAGTTCTCTCAGAAGGG | GTGTGCGGAGATGATCATCAGCATGGACAGCAGCCAGATCCAC    c.840
 K  F  S  Q  K  G  |  C  A  E  M  I  I  S  M  D  S  S  Q  I  H      p.280

          .         .         .         .         .     | 07   .    g.77683
 AGCAAAGACCCCCGTTACGGAGCCAGCCCCCTCCACTGGGCCAAGAACGCAGAG | ATGGCC    c.900
 S  K  D  P  R  Y  G  A  S  P  L  H  W  A  K  N  A  E   | M  A      p.300

          .         .         .         .         .         .       g.77743
 CGCATGCTGCTGAAACGGGGCTGCAACGTGAACAGCACCAGCTCCGCGGGGAACACGGCC       c.960
 R  M  L  L  K  R  G  C  N  V  N  S  T  S  S  A  G  N  T  A         p.320

          .         .         .         .         .         .       g.77803
 CTGCACGTGGCGGTGATGCGCAACCGCTTCGACTGTGCCATAGTGCTGCTGACCCACGGG       c.1020
 L  H  V  A  V  M  R  N  R  F  D  C  A  I  V  L  L  T  H  G         p.340

          .         .         .         .         .        | 08.    g.81131
 GCCAACGCGGATGCCCGCGGAGAGCACGGCAACACCCCGCTGCACCTGGCCATGTCG | AAA    c.1080
 A  N  A  D  A  R  G  E  H  G  N  T  P  L  H  L  A  M  S   | K      p.360

          .         .         .         .         .         .       g.81191
 GACAACGTGGAGATGATCAAGGCCCTCATCGTGTTCGGAGCAGAAGTGGACACCCCGAAT       c.1140
 D  N  V  E  M  I  K  A  L  I  V  F  G  A  E  V  D  T  P  N         p.380

          .         .         .         .       | 09 .         .    g.82274
 GACTTTGGGGAGACTCCTACATTCCTAGCCTCCAAAATCGGCAGAC | TTGTCACCAGGAAG    c.1200
 D  F  G  E  T  P  T  F  L  A  S  K  I  G  R  L |   V  T  R  K      p.400

          .         .         .         .         .         .       g.82334
 GCGATCTTGACTCTGCTGAGAACCGTGGGGGCCGAATACTGCTTCCCACCCATCCACGGG       c.1260
 A  I  L  T  L  L  R  T  V  G  A  E  Y  C  F  P  P  I  H  G         p.420

          .         .         .         .         .         .       g.82394
 GTCCCCGCGGAGCAGGGCTCTGCAGCGCCACATCATCCCTTCTCCCTGGAAAGAGCTCAG       c.1320
 V  P  A  E  Q  G  S  A  A  P  H  H  P  F  S  L  E  R  A  Q         p.440

          .         .         | 10         .         .         .    g.84273
 CCCCCACCGATCAGCCTAAACAACCTAG | AACTACAGGATCTCATGCACATCTCACGGGCC    c.1380
 P  P  P  I  S  L  N  N  L  E |   L  Q  D  L  M  H  I  S  R  A      p.460

          .         .         .         .        | 11.         .    g.87445
 CGGAAGCCAGCGTTCATCCTGGGCTCCATGAGGGACGAGAAGCGGAC | CCACGACCACCTG    c.1440
 R  K  P  A  F  I  L  G  S  M  R  D  E  K  R  T  |  H  D  H  L      p.480

          .         .         .         .         .         .       g.87505
 CTGTGCCTGGATGGAGGAGGAGTGAAAGGCCTCATCATCATCCAGCTCCTCATCGCCATC       c.1500
 L  C  L  D  G  G  G  V  K  G  L  I  I  I  Q  L  L  I  A  I         p.500

          .         .         .         .         .         .       g.87565
 GAGAAGGCCTCGGGTGTGGCCACCAAGGACCTGTTTGACTGGGTGGCGGGCACCAGCACT       c.1560
 E  K  A  S  G  V  A  T  K  D  L  F  D  W  V  A  G  T  S  T         p.520

          .         .         .  | 12      .         .         .    g.89810
 GGAGGCATCCTGGCCCTGGCCATTCTGCACA | GTAAGTCCATGGCCTACATGCGCGGCATG    c.1620
 G  G  I  L  A  L  A  I  L  H  S |   K  S  M  A  Y  M  R  G  M      p.540

          .         .         .         .         .         .       g.89870
 TACTTTCGCATGAAGGATGAGGTGTTCCGGGGCTCCAGGCCCTACGAGTCGGGGCCCCTG       c.1680
 Y  F  R  M  K  D  E  V  F  R  G  S  R  P  Y  E  S  G  P  L         p.560

          .         .         .         .         .         .       g.89930
 GAGGAGTTCCTGAAGCGGGAGTTTGGGGAGCACACCAAGATGACGGACGTCAGGAAACCC       c.1740
 E  E  F  L  K  R  E  F  G  E  H  T  K  M  T  D  V  R  K  P         p.580

    | 13     .         .         .         .         .         .    g.94537
 AA | GGTGATGCTGACAGGGACACTGTCTGACCGGCAGCCGGCTGAACTCCACCTCTTCCGG    c.1800
 K  |  V  M  L  T  G  T  L  S  D  R  Q  P  A  E  L  H  L  F  R      p.600

          .         .         .         .         .         .       g.94597
 AACTACGATGCTCCAGAAACTGTCCGGGAGCCTCGTTTCAACCAGAACGTTAACCTCAGG       c.1860
 N  Y  D  A  P  E  T  V  R  E  P  R  F  N  Q  N  V  N  L  R         p.620

          .          | 14        .         .         .         .    g.95050
 CCTCCAGCTCAGCCCTCAG | ACCAGCTGGTGTGGCGGGCGGCCCGAAGCAGCGGGGCAGCT    c.1920
 P  P  A  Q  P  S  D |   Q  L  V  W  R  A  A  R  S  S  G  A  A      p.640

          .         .         .         .         .         .       g.95110
 CCTACTTACTTCCGACCCAATGGGCGCTTCCTGGACGGTGGGCTGCTGGCCAACAACCCC       c.1980
 P  T  Y  F  R  P  N  G  R  F  L  D  G  G  L  L  A  N  N  P         p.660

          .         .         .         .         .     | 15   .    g.97042
 ACGCTGGATGCCATGACCGAGATCCATGAGTACAATCAGGACCTGATCCGCAAG | GGTCAG    c.2040
 T  L  D  A  M  T  E  I  H  E  Y  N  Q  D  L  I  R  K   | G  Q      p.680

          .         .         .         .         .         .       g.97102
 GCCAACAAGGTGAAGAAACTCTCCATCGTTGTCTCCCTGGGGACAGGGAGGTCCCCACAA       c.2100
 A  N  K  V  K  K  L  S  I  V  V  S  L  G  T  G  R  S  P  Q         p.700

          .         .         .         .         .         .       g.97162
 GTGCCTGTGACCTGTGTGGATGTCTTCCGTCCCAGCAACCCCTGGGAGCTGGCCAAGACT       c.2160
 V  P  V  T  C  V  D  V  F  R  P  S  N  P  W  E  L  A  K  T         p.720

          .         .         .         .   | 16     .         .    g.98131
 GTTTTTGGGGCCAAGGAACTGGGCAAGATGGTGGTGGACTGT | TGCACGGATCCAGACGGG    c.2220
 V  F  G  A  K  E  L  G  K  M  V  V  D  C   | C  T  D  P  D  G      p.740

          .         .         .         .         .       | 17 .    g.98389
 CGGGCTGTGGACCGGGCACGGGCCTGGTGCGAGATGGTCGGCATCCAGTACTTCAG | ATTG    c.2280
 R  A  V  D  R  A  R  A  W  C  E  M  V  G  I  Q  Y  F  R  |  L      p.760

          .         .         .         .         .         .       g.98449
 AACCCCCAGCTGGGGACGGACATCATGCTGGATGAGGTCAGTGACACAGTGCTGGTCAAC       c.2340
 N  P  Q  L  G  T  D  I  M  L  D  E  V  S  D  T  V  L  V  N         p.780

          .         .         .         .         .         .       g.98509
 GCCCTCTGGGAGACCGAGGTCTACATCTATGAGCACCGCGAGGAGTTCCAGAAGCTCATC       c.2400
 A  L  W  E  T  E  V  Y  I  Y  E  H  R  E  E  F  Q  K  L  I         p.800

          .         .                                               g.98530
 CAGCTGCTGCTCTCACCCTGA                                              c.2421
 Q  L  L  L  S  P  X                                                p.806

          .         .         .         .         .         .       g.98590
 gggtccccagcctctcaccggccccagctgacctcgtccattcagcccctgccaggccaa       c.*60

          .         .         .         .         .         .       g.98650
 gcccagccactgccctcccgggcagatctgggcccaggcacctctgagtccatagaccag       c.*120

          .         .         .         .         .         .       g.98710
 gcctgggagaatgccaagctgcctgcccgaggctggtcctgaaggcctgtctcccactaa       c.*180

          .         .         .         .         .         .       g.98770
 ccccgccttccagcactttctgtcattccaggctgggaaagtctagagccccctttggcc       c.*240

          .         .         .         .         .         .       g.98830
 cctttccctgactgtcaaggacaactgactcccccatcagctcaaacattaagggtaccc       c.*300

          .         .         .         .         .         .       g.98890
 gggcacaaccgtacccctgcccccagccccagcctccctgagggcctgccgggctgcctc       c.*360

          .         .         .         .         .         .       g.98950
 tgccccagcccccagcaagggcactcccaggcttcctggtgggtgcagcccactccctct       c.*420

          .         .         .         .         .         .       g.99010
 gccctctgctccgttccctgggggctgggactaaagaaatgggtgtcccccaccccatca       c.*480

          .         .         .         .         .         .       g.99070
 gctgggaaagcccaggccgcaggagtgggatgcccgttggactttgcccctcacactggc       c.*540

          .         .         .         .         .         .       g.99130
 ccagcccctcacactgccccaccccgagaaccctcagctctcaaaggtcactcctgggag       c.*600

          .         .         .         .         .         .       g.99190
 tttcttcttcccaatggaagtggcttaagagccaaaactgaaataaatcatttggattca       c.*660

                                                                    g.99196
 agttca                                                             c.*666

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Phospholipase A2, group VI (cytosolic, calcium-independent) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center