(intronic numbering for coding DNA Reference Sequence)
. . . . g.26645
gtgagctggggcccaactggggctggtctgggcctgggggt c.550+41
--------------------- middle of intron ---------------------
g.26646 . . . . g.26685
c.551-40 acccagcctggcccctgatctctgcccctgctggtcacag c.551-1
Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center